|
| Status |
Public on Feb 17, 2017 |
| Title |
total input RNA, ribo-zero rep1 |
| Sample type |
SRA |
| |
|
| Source name |
HEK 293T stably overexpressiong Flag-SIRT7
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HEK 293T
overexpression construct: Flag-SIRT7
passages: 10~15
|
| Growth protocol |
HEK293T cells stably overexpressing Flag-tagged SIRT7 were cultured in DMEM supplemented with 10% FBS (fetal bovine serum) and penicillin-streptomycin
|
| Extracted molecule |
total RNA |
| Extraction protocol |
The total cellular RNA was extracted by TRI reagent according to manufacturer's instruction. For the extraction of total SIRT7-RIP RNA, we performed RIP (RNA immunoprecipitation) experiment. Briefly, the lysates were incubated with anti-Flag M2 affinity gel to immunoprecipitate SIRT7 ribonucleoprotein complex (RNP) . Anti-Flag beads were washed extensively and then subjected to proteinase K digestion to release RNA from SIRT7 RNP. RNA associated with SIRT7 was then extracted by standard phenol-chloroform extraction followed with ethanol precipitation. Ribosomal RNA was substracted from both input cellular RNA and SIRT7-RIP RNA during library construction with the Ribozero Gold HMR kit (Illumina).
Directional RNA-seq libraries were prepared from 25-100ng rRNA-subtracted RNA using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs).
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
input
|
| Data processing |
Illumina pipeline software v1.8 was used for base calling.
cutadapt v1.5 (-m 20 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads.
bowtie2 v2.2.6 (default params) was used to divide reads into 2 sets: matching and not matching rRNA (and other noncoding, non-polyA+ RNAs such as microRNAs, snoRNAs, snRNAs, etc).
tophat v2.0.13 (--no-novel-juncs --library-type fr-firststrand) was used to map non-rRNA reads to the Human hg19 reference genome (UCSC).
cuffquant (--no-novel-juncs --library-type fr-firststrand) was used to quantify transcripts based on the Human hg19 reference transcriptome (UCSC).
cuffdiff v2.2.1 (--library-type fr-firststrand) was used to call differentially expressed genes based on the Human hg19 reference transcriptome (UCSC).
Genome_build: Human hg19 (UCSC)
Supplementary_files_format_and_content: Tab delimited text files including counts, FPKM values, and p-values generated from Cuffdiff2 when corrected for multiple hypothesis testing
|
| |
|
| Submission date |
May 24, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
Jennifer K Grenier |
| Organization name |
Cornell University
|
| Department |
Biomedical Sciences
|
| Lab |
Biotechnology Building rm 333
|
| Street address |
526 Campus Rd
|
| City |
Ithaca |
| State/province |
NY |
| ZIP/Postal code |
14853 |
| Country |
USA |
| |
|
| Platform ID |
GPL18573 |
| Series (2) |
| GSE81840 |
SIRT7 is an RNA-activated protein lysine deacylase [RIP-seq ribo-zero] |
| GSE81841 |
SIRT7 is an RNA-activated protein lysine deacylase |
|
| Relations |
| BioSample |
SAMN05172291 |
| SRA |
SRX1798518 |
