|
| Status |
Public on Feb 01, 2016 |
| Title |
FRI;flc-3 fully-expanded leaf 7, day 29 |
| Sample type |
SRA |
| |
|
| Source name |
fully-expanded leaf 7 (rosette leaf)
|
| Organism |
Arabidopsis thaliana |
| Characteristics |
genetic background: Col-0 with FRI introgressed from Sf-2
genotype: FRI;flc-3
tissue: fully-expanded leaf 7 (rosette leaf)
days after plants put in the growth chamber: 29
day length: 16 hours (long day conditions)
5'-adapter with index base followed by an asterisk: 5' GUUCAGAGUUCUACAGUCCGACGAUCA*UC 3'
|
| Growth protocol |
Plants were sown in MetroMix 360 soil (Sun Gro Horticulture, Vancouver, British Columbia, Canada) in 12-well (for the shoot apex and primordia collections) or 96-well flats (for the fully-expanded leaf collections). Flats were elevated on supports above a water reservoir, with wicks made from strips of batting extending from each pot into the reservoir to ensure a constant moisture level. Flats were kept at 4oC for five days, and then grown at 23oC under long day conditions (16 hr light :8 hr dark) at a light intensity of 100-125 µ-mol m-2 s-1, provided by a one-to-one ratio of T8 Sylvania Octron (4100K Ecologic), and GroLite WS fluorescent lamps (Interlectric). Flats were covered with a clear dome for the first 3-5 days to aid germination. Plants were fertilized twice—at planting and at 20 days—with Peters 15-16-17. Plant age was measured from the date flats were transferred to the growth chamber.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Samples were collected in tubes submerged in liquid nitrogen, so that the tissues were instantly flash frozen. RNA was extracted by Trizol (Life Technologies), followed by a chloroform phase separation according to the manufacturer's protocol. We then performed a second extraction using a 5:1 mix of acid phenol:chlorform, pH 4.5, and precipitated with 2 volumes of isopropanol.
Libraries were made by a home assembled and modified version of Illumina's 2007 small RNA sequencing kit protocol. For each library, 20-30 nt small RNAs were selected by running 10 ug of total RNA on a 15% polyacrylamide/urea gel, using a 10 bp DNA ladder to identify the correct size range. The RNA was eluted from the gel slice by crushing the gel and adding 2-3 gel volumes of 0.3 M NaCl and shaking overnight. Following filtering out the gel, the RNA was precipitated with 3 volumes of 100% ethanol and 20 ug glycogen. The 5' adapter (a modified Illumina Genome Analyzer II adapter of sequence listed above) was ligated using T4 RNA ligase 1 (Ambion) at room temperature for 6 hours. Free 5' adapters and non-adapter-ligated small RNAs were removed by running the product on a second 15% polyacrylamide/urea gel and cutting and saving the 49-65 nt portion of the gel. The RNA was eluted and precipitated as before. The 3' adapter (the same sequence as the Illumina Genome Analyzer II 3' adapter) was then ligated, again using T4 RNA ligase 1 at room temperature for 6 hours. Free 3' adapter and RNAs lacking a 3' adapter were removed by running the samples on a 7.5% polyacrylamide/urea gel and cutting and saving the 68-88 nt portion of the gel. The RNA was eluted and precipitated as before. RT-PCR and PCR were performed using the Illumina Genome Analyzer II primers. RT-PCR was performed using Superscript II (Life Technologies) and PCR using Phusion (New England Biolabs). The final product was run on a 10% non-denaturing polyacrylamide gel, and the band around 92 bp was cut, and eluted and precipitated as before. sRNA-seq, with 36 nt reads for all apex libraries and 35 nt reads for the leaf and cotyledon libraries.
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer II |
| |
|
| Description |
small RNA
|
| Data processing |
Adapter sequences were trimmed from raw sequence reads. Only trimmed reads were used in further processing
Sequence data processing was conducted using in-house Perl scripts developed by Meyers lab in University of Delaware
Genome_build: TAIR9
Supplementary_files_format_and_content: text file with sequences and read count
|
| |
|
| Submission date |
Aug 24, 2015 |
| Last update date |
Feb 01, 2016 |
| Contact name |
Blake C. Meyers |
| E-mail(s) |
bmeyers@danforthcenter.org
|
| Phone |
314-587-1422
|
| Organization name |
Donald Danforth Plant Science Center
|
| Lab |
Meyers lab
|
| Street address |
975 N Warson Road
|
| City |
St. Louis |
| State/province |
MO |
| ZIP/Postal code |
63132 |
| Country |
USA |
| |
|
| Platform ID |
GPL9302 |
| Series (1) |
| GSE72303 |
The effect of developmental transitions on small RNAs in Arabidopsis thaliana shoots |
|
| Relations |
| BioSample |
SAMN04009399 |
