 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 22, 2015 |
| Title |
Ch17.B76-PM-2hrs-bio-replicate1 |
| Sample type |
SRA |
| |
|
| Source name |
C127 cells
|
| Organism |
Mus musculus |
| Characteristics |
cell cycle phase: 2 hrs post-mitosis
cell line: C127
|
| Treatment protocol |
Cultures were synchronized at mitosis using a 4 hr nocodazole block and then released into G1 for 0.5, 1, 2, 3, 4 hr. G2 syncheonization was obtained by 15 hr release. Cells were synchronized in G0 by 5 day serum starvation.
|
| Growth protocol |
C127 cells were grown in DMEM with 10% fetal calf serum as decribed in (Lu J et.al, 2010)
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Cell cycle synchronized cultures were crosslinked for 10 minutes at RT in 1% formaldehyde. The reaction was quenched for 5 min at RT. We then applied 4C-seq method. Briefly, nuceli were isolated from the cross-linked cells and digested using the restriction enzyme HindIII. Fragments were ligated under dilute conditions and reversed cross-linked. The samples were then digested with DpnII and circularized. Subsequently bait specific primers were used to amplify the interaction partners and sequenced using the Illumina HiSeq 2500 platform, generating 50 bp reads.
Libraries were generated by amplifying the 4C template using bait specific primers with added illumina adaptors. Bait is the genomic loci of interest whose genome-wide interactions are being measured by 4C-seq. We denote each bait by its chromosome followed by letter B and the approximate megabase-scale coordinate of the bait (e.g. Ch8.B26 means bait with a coordinate on 26th megabase of chromosome 8). Twelve baits were chosen based on their replication timing regulation and were named Ch8.B7,Ch8.B26,Ch8.B44,Ch8.B53,Ch8.B87,Ch8.B118,Ch16.B30,Ch16.B41,Ch16.B46,Ch16.B48,Ch17.B50,Ch17.B50 Coordinates are in mm9.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
bar code: AGGAGATGGCAAACCACATTAAGC
4C-seq library constructed using HindIII.
|
| Data processing |
Library strategy: 4C-seq
50 bp-long single-end reads were first de-multiplexed using their barcodes and assigned to the corresponding time point and 4C bait. Only the reads that contained one of the valid barcodes was retained for mapping.
Each read was mapped to the mouse genome (UCSC mm9) using the short read alignment mode of BWA (v0.5.9) with default parameter settings. Mapping results were post-processed, and only the reads that mapped uniquely with an alignment quality score of at least 30 and an edit distance of at most 1 were qualified for further analysis.
Each qualified read was assigned to the nearest HindIII cleavage site which represents a restriction fragment.
50 kb upstream and downstream of the bait position was removed from this raw data.
Contact counts at HindIII sites for all chromosomes were windowed (10 kb windows), normalized for sequencing depth and smoothed using a running mean with a span of 30 windows. The resulting smoothed profiles (contact count) were plotted as a function of distance along the chromosome.
Genome_build: mm9
Supplementary_files_format_and_content: rawContactCounts.txt file lists the starting coordinates of all HindIII fragments (defined as the 6-bp recognition site of AAGCTT) and for each such fragment the number of contact counts assigned to that fragment by mapping the library listed in each column.
|
| |
|
| Submission date |
Mar 05, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
David M. Gilbert |
| E-mail(s) |
gilbert@bio.fsu.edu
|
| Phone |
8506457583
|
| Organization name |
Florida State University
|
| Street address |
319 Stadium Drive
|
| City |
Tallahassee |
| State/province |
Florida |
| ZIP/Postal code |
32306-4295 |
| Country |
USA |
| |
|
| Platform ID |
GPL17021 |
| Series (1) |
| GSE66579 |
Topologically-associating domains and their long-range contacts are established during early G1 coincident with the establishment of the replication timing program |
|
| Relations |
| BioSample |
SAMN03389562 |
| SRA |
SRX902504 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
