GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM1372425

Query DataSets for GSM1372425

Status

Public on Oct 20, 2014

Title

CMV-Fny infection (small RNA)

Sample type

SRA

Source name

Tomato micro-Tom

Organism

Solanum lycopersicum

Characteristics

strain: Micro-Tom
tissue: Tomato leaves
age: 20 days post inoculation
infection: CMV-Fny

Treatment protocol

CMV-Fny, a typical strain of CMV subgroup I, was reconstituted from infectious clones, and maintained on Nicotiana tabacum. Inoculation was carried out by mechanical inoculation on the first true leaves of 14-day old tomato seedlings, with sap prepared from systemically infected tobacco leaf tissues homogenized in 20 volumes of 100 mM sodium phosphate buffer, pH7.2. Mock-treated tomatoes were inoculated with sodium phosphate buffer only.

Growth protocol

The miniature tomato cultivar, micro-Tom, was used as host plants in our study. Tomato seedlings were grown in a greenhouse at 12 h day/12 h night (18-22°C) and light intensity of >8000 lx.

Extracted molecule

total RNA

Extraction protocol

Small RNA sequencing libraries were generated from Group A and group B. Firstly, small RNA fractions between 18-30 nt were isolated from 10 g total RNAs by 15% denaturing polyacrylamide gel electrophoresis. After recovering the isolated RNAs, the obtained short RNAs were then ligated to the 5'(GUUCAGAGUUCUACAGUCCGACGAUC) and 3'(P-UCGUAUGCCGUCUUCUGCUUG-UidT) chimeric oligonucleotide adapters, and reverse transcribed to single-stranded cDNAs with an RT primer (CAAGCAGAAGACGGCATACGA). Subsequently, the cDNAs were PCR amplified using primers that annealed to the ends of adapters. Finally, the amplification products were sequenced using High-seq 2000 sequencing platform (LC Sciences).Degradome sequencing libraries were constructed using mRNA isolated from total RNA samples used in small RNA sequencing. Library construction comprises the following steps: 1) Poly-adenylated RNA molecules are isolated ; 2) RNA adapter is added to the 5’ ends of the single-stranded RNA molecules; 3) Reverse transcriptase is used to generate the first strand of cDNA using an oligo (dT) with a 3’ adapter sequence; 4) A short PCR is used to amplify the cDNA to obtain sufficient quantities of template; 5) The product of the PCR reaction is then digested with MmeI ; 6) A 3’ adapter with degenerate nucleotides in the overhang region is ligated to the MmeI digestion products 7) The resulting material is PCR amplified, gel purified and used for sequencing.

Library strategy

miRNA-Seq

Library source

transcriptomic

Library selection

size fractionation

Instrument model

Illumina HiSeq 2000

Description

miRNA-Seq
FJL_B

Data processing

The raw small RNA sequencing data were firstly processed with an in-house program called LCS ACGT101-miR v4.2 (LC Sciences, Texas, USA), to filter out the adapter sequences. Then, the extracted small RNA sequences with 15-29 nt in length were subjected to mRNA, RFam, Repbase filters. Finally, the remaining unique sequences were compared to the miRNA database (ftp://mirbase.org/pub/mirbase/CURRENT/) and Solanum Genome network (http://solgenomics.net/) for miRNA and pre-miRNAs identification and novel miRNA prediction .
To identify potential novel miRNAs in tomato, the unmapped small RNA sequences were BLASTed against the tomato genome and folded into a secondary structure by Mfold software (http://mfold.rna.albany.edu/) and Vienna RNAfold software (http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi). Only the non-coding sequence which could form a perfect stem-loop structure and meet the criteria for miRNAs prediction were then considered to be a novel potential candidate miRNA (PC-miRNA).
The raw reads for each small RNA sequence were firstly normalized by the global normalization procedures, then the differentially expressed sequence counts in mock- and CMV-infected tomato were analyzed by the online service IDEG6 (http://telethon.bio.unipd.it/bioinfo/IDEG6_form/).
In degradome sequencing, raw sequencing reads were obtained using Illumina’s Pipeline v1.5 software to remove adaptor sequences and low quality sequencing reads. The extracted sequencing reads with the length of 20 and 21 nt were then used to identify potentially cleaved targets by the CleaveLand pipeline. The degradome reads were mapped to tomato mRNA database (http://www.sgn.cornell.edu/about/tomato_sequencing.pl). Only the perfect matching alignment(s) for the given read would be kept and extend to 35-36 nt by adding 15 nt of upstream of the sequence. All resulting reads (t-signature) were reverse-complemented and aligned to the miRNA identified in our study.
Genome_build: solanum lycopersicum genome：http://solgenomics.net ftp://ftp.solgenomics.net/est sequences/species/Tomato
Supplementary_files_format_and_content: All_Expressed_miRNA_output4.txt is the summary of small RNA sequences detected in this study (referred to miRbase 20.0).FJL01_short_outfile_1_anno.txt is the predict targets of all plant miRNAs identified in mock infected library and their GO analysis. FJL02_short_outfile_1_anno2.txt is the predict targets of all plant miRNAs identified in CMV-Fny infected library and their GO analysis.

Submission date

Apr 22, 2014

Last update date

May 15, 2019

Contact name

Junli Feng

E-mail(s)

fengjunli0722@foxmail.com

Organization name

Zhejiang Gongshang University

Street address

Hangzhou, Jiaogong Road 149#