|
| Status |
Public on Aug 11, 2014 |
| Title |
scRNA_control_untreated_replicate1 |
| Sample type |
SRA |
| |
|
| Source name |
Serum-starved (72h) Swiss 3T3 fibroblasts, replicate 1
|
| Organism |
Mus musculus |
| Characteristics |
cell line: Swiss 3T3
cell type: fibroblasts
|
| Treatment protocol |
Serum-straved (72 h) mouse 3T3 fibroblasts we treated with 188.5 nM of anisomycin (Sigma) for 1 h.
|
| Growth protocol |
Swiss 3T3 fibroblasts were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% (vol/vol) fetal calf serum (FCS) in the presence of Penicillin and Streptomycin. The cells were serum-deprived for 72 h using DMEM containing 0.2% FCS (vol/vol).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
The cells growing onto 15-cm Petri dishes were washed twice with 10 ml of ice cold PBS, harvested in 5 ml of ice cold PBS and centrifuged for 5 min 500 x g, 4oC. The cell pellet was resuspended in 10 ml of Solution I (150 mM KCl, 4 mM MgOAc, 10 mM Tris-HCl pH 7.4) and spun down for 5 min at 500 x g, 4oC. The supernatant was removed; the cells were reuspended in 10 ml of Solution II (Solution I + 0.5% NP40) and incubated on ice for 10 min. The nuclei were pelleted through a 4 ml cushion of 0.6 M sucrose at 900 x g for 10 min, 4oC. All but 200 l of supernatant was removed and 2 ml of Solution I was added. The pellet was resuspended and spun down at 900 x g for 5 min, 4oC. Following the removal of the supernatant, 1 ml of Trizol® reagent (Invitrogen) was added and RNA was further isolated according to the manufacturer's protocol.
scRNA-seq was performed as described (Nechaev et al., Science 2010), with modifications.The following adapters and primers were used: 3’adaptor_PE: 5‘-/5Phos/rArGrATCGGAAGAGCGGTTCAGC/3ddC/ -3‘; 5’adaptor_PE: 5‘rArCrArCrUrCrUrUrUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrU-3‘; RT_Primer_PE (primer for reverse transcription):5‘- TCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT -3‘; Library amplification primers: 5‘-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’ and 5‘-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT-3’. Briefly, 10 μg of nuclear RNA was size selected on a 15% TBE-urea gel (Bio-Rad) and RNA molecules sized between 25 nt and 120 nt were extracted and subjected to RNA 5’Polyphosphatase treatment (1 u/μl, Epibio) for 30 min at 37oC and subsequently with Terminator 5’phosphate-Dependent Exonuclease (0.05 u/μl, Epibio) for 60 min at 30oC, what was followed by ligation of 30 pmol of 3’adapter in the presence of 0.1 u/μl of T4 ssRNA Ligase I ( NEB) and 1 mM of ATP at 20oC for 6 hours. Then RNA was size selected on 15% TBE-urea gel (Bio-Rad), RNA molecules between 50 nt and 150 nt were excised and treated with 1 μl of APexTM Heat-Labile Alkaline Phosphatase (Epibio) for 10 min at 37oC followed by the treatment with 2.5 u of Tobacco Acid Pyrophosphatase (Epibio) for 1 hour at 37oC. Subsequently, 50 pmol of 5’adapter was ligated in the presence of 0.1 u/μl of T4 ssRNA Ligase I (NEB) and 1mM of ATP at 20oC for 6 hours. Following size selection on 10% TBE-urea gel (Bio-Rad), RNA was subjected to reverse transcription using Superscript III Reverse Transcriptase kit (Invitrogen). cDNA was amplified using PhusionTM DNA Polymerase (Finnzymes), 15 cycles of amplification were performed. The library was size selected on 6% TBE gel (Rio-Rad).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer IIx |
| |
|
| Description |
Short-capped RNA after 72h starvation in the medium containing 0.2% FCS (replicate1)
|
| Data processing |
Base callling was performed using RTA version 1.8.70.0 (samples scRNA_0h_1 and scRNA_1hA_1) and RTA version 1.13.48.0 (samples scRNA_0h_2 and scRNA_1hA_2).
Following adapter removal, reads derived from scRNA-seq were first trimmed to 25bp and then mapped to the mouse genome (mm9) using TopHat version 1.4.1 allowing for one mismatchin a n 18bp segment. Only uniquely mapped reads were retained.
Duplicated reads were removed a bedgraph file (normalized to the total library size) using genomeCoverageBed -bga from BedTools was generated. Chromosome size information was downloaded from UCSC. BigWig files were generated from bedgraph files using bedGraphToBigWig.
Genome_build: mm9
Supplementary_files_format_and_content: read desity at genomic positions (bigWig format)
|
| |
|
| Submission date |
Mar 11, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Anna Sawicka |
| E-mail(s) |
anna.sawicka@mpibpc.mpg.de
|
| Organization name |
Max Planck Institure for Biophysical Chemistry
|
| Department |
Dep. of Molecular Biology
|
| Lab |
Cramer
|
| Street address |
Am Fassberg 11
|
| City |
Goettingen |
| ZIP/Postal code |
37077 |
| Country |
Germany |
| |
|
| Platform ID |
GPL11002 |
| Series (2) |
| GSE55775 |
Promoter proximal pausing in response to stress in serum deprived mouse fibroblasts. |
| GSE55784 |
Genome-wide analysis of stress response in mouse fibroblasts |
|
| Relations |
| BioSample |
SAMN02687778 |
| SRA |
SRX484329 |
