NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL21558 Query DataSets for GPL21558
Status Public on Mar 03, 2016
Title [OncoScan_CNV] Affymetrix OncoScan CNV FFPE Assay
Technology type in situ oligonucleotide
Distribution commercial
Organism Homo sapiens
Manufacturer Affymetrix
Manufacture protocol see manufacturer's web site
 
Description OncoScan_CNV.na33.r1.annot.csv
#%create_date=2013-09-24 GMT-08:00 18:05:59
#%chip_type=OncoScan_CNV
#%genome-species=Homo sapiens
#%genome-version=hg19
#%genome-version-ucsc=hg19
#%genome-version-ncbi=37
#%genome-version-create_date=2009-02-00
#%dbSNP-date=2011-03-11
#%dbSNP-version=135
#%hapmap-date=2008-01-08
#%hapmap-version=23
#%dgv-date=2010-10-00
#%dgv-version=10
#%netaffx-annotation-date=2012-11-05
#%netaffx-annotation-netaffx-build=33
 
Web link http://www.affymetrix.com/support/technical/byproduct.affx?product=oncoscan_cnv_ffpe_assay_kit
Submission date Mar 03, 2016
Last update date Mar 03, 2016
Organization Affymetrix, Inc.
E-mail(s) geo@ncbi.nlm.nih.gov, support@affymetrix.com
Phone 888-362-2447
URL http://www.affymetrix.com/index.affx
Street address
City Santa Clara
State/province CA
ZIP/Postal code 95051
Country USA
 
Samples (1680) GSM2079975, GSM2079977, GSM2080007, GSM2080008, GSM2080009, GSM2080010 
Series (47)
GSE78872 Genome-wide analysis of pediatric-type follicular lymphoma reveals a low genetic complexity and recurrent alterations of TNFRSF14 gene
GSE80103 Genome-wide analysis of t(14;18)-negative/BCL2 expression-negative FL
GSE85937 Genome profiling of free circulating tumor DNA by oncoscan and comparison to profiles in tumor biopsies evaluated by cytoscan

Data table header descriptions
ID
dbSNP RS ID
Chromosome
Physical Position
Strand
Strand Versus dbSNP
ChrX pseudo-autosomal region 1
ChrX pseudo-autosomal region 2
Cytoband
Flank
Allele A
Allele B
In Hapmap
Probe Count
Process Flag
% GC
Copy Number Variation
Genetic Map
Microsatellite
Associated Gene
OMIM
SPOT_ID

Data table
ID dbSNP RS ID Chromosome Physical Position Strand Strand Versus dbSNP ChrX pseudo-autosomal region 1 ChrX pseudo-autosomal region 2 Cytoband Flank Allele A Allele B In Hapmap Probe Count Process Flag % GC Copy Number Variation Genetic Map Microsatellite Associated Gene OMIM SPOT_ID
S-tag000001 rs38744 7 111048579 + same 0 0 q31.1 ATAAAGATTTTTCTAGTGCATCAT[A/G]TCACAGAACTGCAAGCATA A G YES 6 3 A // 14.0000 /// local // 0.3672 Variation_10206 // 7:111044971-111112853 // Illumina HumanHap550 BeadChip // 17921354 // Wang et al. (2007) // CopyNumber /// Variation_103745 // 7:111048575-111056882 // Affymetrix Human SNP array 6.0 and Illumina Human 1M BeadChip // 20811451 // Altshuler et al. (2010) // CopyNumber /// Variation_1163 // 7:111048579-111080407 // Mendelian inconsistencies // 16327808 // Conrad et al. (2005) // CopyNumber /// Variation_3698 // 7:110800911-111304825 // BAC Array CGH // 17122850 // Redon et al. (2006) // CopyNumber /// Variation_38653 // 7:111048575-111056882 // Affymetrix SNP 6.0 Array // 18776908 // McCarroll et al. (2008) // CopyNumber /// Variation_52053 // 7:110813808-111048579 // Illumina HumanHap550 V1 BeadChip // 19592680 // Shaikh et al. (2009) // CopyNumber /// Variation_52056 // 7:111048579-111078912 // Illumina HumanHap550 V1 BeadChip // 19592680 // Shaikh et al. (2009) // CopyNumber /// Variation_5401 // 7:110821726-111158074 // Illumina HumanHap300 BeadChip // 17116639 // Simon-Sanchez et al. (2007) // CopyNumber /// Variation_64920 // 7:111022673-111100065 // Agilent custom oligo CGH array // 19812545 // Conrad et al. (2009) // CopyNumber /// Variation_64921 // 7:111022673-111100065 // Agilent custom oligo CGH array // 19812545 // Conrad et al. (2009) // CopyNumber /// Variation_9066 // 7:110787970-111113591 // Affymetrix 500K SNP Mapping Array // 17911159 // Pinto et al. (2007) // CopyNumber /// Variation_9067 // 7:110981049-111114049 // Affymetrix 500K SNP Mapping Array // 17911159 // Pinto et al. (2007) // CopyNumber /// Variation_9068 // 7:111007049-111318464 // Affymetrix 500K SNP Mapping Array // 17911159 // Pinto et al. (2007) // CopyNumber /// Variation_94810 // 7:111046925-111091760 // Custom Affymetrix oligonucleotide arrays // 19900272 // Matsuzaki et al. (2009) // CopyNumber deCODE // 120.1430 // 156.0457 // 84.2403 /// Marshfield // 121.7801 // 153.0385 // 91.1885 /// SLM1 // 116.5145 // 147.2000 // 87.5316 D7S1559 // downstream // 65157 /// D7S2860 // upstream // 69352 ENST00000331762 // intron // 0 // Hs.731706 // IMMP2L // 83943 // IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) /// ENST00000405709 // intron // 0 // Hs.731706 // IMMP2L // 83943 // IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) /// ENST00000415362 // intron // 0 // Hs.731706 // IMMP2L // 83943 // IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) /// ENST00000437687 // intron // 0 // Hs.731706 // IMMP2L // 83943 // IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) /// ENST00000447215 // intron // 0 // Hs.731706 // IMMP2L // 83943 // IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) /// ENST00000452895 // intron // 0 // Hs.731706 // IMMP2L // 83943 // IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) /// NM_001244606 // intron // 0 // Hs.731706 // IMMP2L // 83943 // IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) /// NM_032549 // intron // 0 // Hs.731706 // IMMP2L // 83943 // IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) --- dbSNP RS ID: rs38744
S-tag000002 rs148371779 X 132363050 + same 0 0 q26.2 TGGACATGTTCTGGGCAAA[C/T]GACAGGAAGCAGAAGAGC T C --- 6 3 A // 19.0000 /// local // 0.4175 --- deCODE // 135.4540 // 135.4540 // --- /// Marshfield // 82.3105 // 143.7209 // 22.7700 /// SLM1 // 95.4483 // 148.8276 // 43.6000 DXS7853 // downstream // 63778 /// DXS6748 // upstream // 34505 ENST00000310125 // upstream // 10674 // Hs.142908 // TFDP3 // 51270 // transcription factor Dp family, member 3 /// ENST00000365329 // downstream // 9635 // --- // --- // --- // --- /// NM_001448 // downstream // 72014 // Hs.58367 // GPC4 // 2239 // glypican 4 /// NM_016521 // upstream // 10674 // Hs.142908 // TFDP3 // 51270 // transcription factor Dp family, member 3 --- dbSNP RS ID: rs148371779
S-tag000003 rs11048499 12 26556111 + same 0 0 p11.23 AACACAGGATGAGCAAAGG[C/T]AAACAGGCACAAAAGCATG T C YES 6 3 A // 17.0000 /// local // 0.3898 --- deCODE // 48.8394 // 45.2923 // 52.3843 /// Marshfield // 46.4268 // 47.5810 // 44.6770 /// SLM1 // 46.4646 // 48.5432 // 45.1000 D12S2033 // downstream // 65767 /// D12S1316 // upstream // 303688 ENST00000381340 // intron // 0 // Hs.512235 // ITPR2 // 3709 // inositol 1,4,5-trisphosphate receptor, type 2 /// ENST00000451599 // intron // 0 // Hs.512235 // ITPR2 // 3709 // inositol 1,4,5-trisphosphate receptor, type 2 /// ENST00000535324 // intron // 0 // Hs.577737 // --- // --- // Transcribed locus /// NM_002223 // intron // 0 // Hs.512235 // ITPR2 // 3709 // inositol 1,4,5-trisphosphate receptor, type 2 --- dbSNP RS ID: rs11048499
S-tag000004 rs7748125 6 103391000 + same 0 0 q16.3 CTACACAAAAGTAACATCATTACTAT[A/G]TGACATGCATCAAGAACCAT A G YES 6 0 A // 15.0000 /// local // 0.3454 Variation_7512 // 6:103274726-103502648 // Agilent 185k CGH Arrays/Agilent Custom CGH Arrays // 17666407 // de Smith et al. (2007) // CopyNumber deCODE // 106.5001 // 139.7210 // 73.2800 /// Marshfield // 110.5774 // 147.6570 // 74.3800 /// SLM1 // 107.7904 // 132.2130 // 84.4904 D6S2160 // downstream // 198647 /// D6S1580 // upstream // 79186 ENST00000407015 // upstream // 59389 // --- // --- // --- // --- /// ENST00000407792 // upstream // 489333 // --- // --- // --- // --- /// NM_001166247 // downstream // 873042 // Hs.98262 // GRIK2 // 2898 // glutamate receptor, ionotropic, kainate 2 /// NM_020771 // downstream // 1784968 // Hs.434340 // HACE1 // 57531 // HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 138244 // Mental retardation, autosomal recessive, 6 // 611092 // downstream dbSNP RS ID: rs7748125
S-tag000005 rs10895822 11 97346172 + same 0 0 q22.1 CACAACAAGAAGGTGTAAGAAG[C/T]AGAATTGGCTGAAATTAAGGAA T C YES 6 3 A // 16.0000 /// local // 0.3564 Variation_0309 // 11:97260050-97441173 // ROMA // 15273396 // Sebat et al. (2004) // CopyNumber deCODE // 100.7534 // 136.6800 // 64.8368 /// Marshfield // 93.9171 // 112.5380 // 74.7751 /// SLM1 // 85.2900 // 109.0900 // 61.7836 D11S2070 // downstream // 144990 /// D11S920 // upstream // 111244 ENST00000362445 // upstream // 182292 // --- // --- // --- // --- /// ENST00000529088 // upstream // 215185 // --- // --- // --- // --- /// NM_001243271 // upstream // 1545534 // Hs.656783 // CNTN5 // 53942 // contactin 5 /// NR_047481 // upstream // 1106131 // --- // JRKL-AS1 // 100874053 // JRKL antisense RNA 1 (non-protein coding) --- dbSNP RS ID: rs10895822
S-tag000007 rs10277237 7 150683344 + same 0 0 q36.1 CTGGATCCGCGCAGCA[A/G]AACAACATCTCCTCTAGGAAG A G YES 6 3 A // 20.0000 /// local // 0.5118 --- deCODE // 162.0613 // 211.6383 // 112.4824 /// Marshfield // 161.6459 // 209.9813 // 113.6900 /// SLM1 // 159.5107 // 204.6000 // 116.8000 D7S1826 // downstream // 59275 /// D7S759 // upstream // 11234 ENST00000262186 // upstream // 7941 // Hs.647099 // KCNH2 // 3757 // potassium voltage-gated channel, subfamily H (eag-related), member 2 /// ENST00000297494 // upstream // 4739 // Hs.647092 // NOS3 // 4846 // nitric oxide synthase 3 (endothelial cell) /// NM_000603 // upstream // 4800 // Hs.647092 // NOS3 // 4846 // nitric oxide synthase 3 (endothelial cell) /// NM_172056 // upstream // 7942 // Hs.647099 // KCNH2 // 3757 // potassium voltage-gated channel, subfamily H (eag-related), member 2 152427 // Long QT syndrome-2 // 613688 // upstream /// 152427 // {Long QT syndrome-2, acquired, susceptibility to} // 613688 // upstream /// 152427 // Short QT syndrome-1 // 609620 // upstream /// 163729 // {Coronary artery spasm 1, susceptibility to} // --- // upstream /// 163729 // {Alzheimer disease, late-onset, susceptibility to} // 104300 // upstream /// 163729 // {Hypertension, susceptibility to} // 145500 // upstream /// 163729 // {Hypertension, pregnancy-induced} // 189800 // upstream /// 163729 // {Placental abruption} // --- // upstream /// 163729 // {Ischemic stroke, susceptibility to} // 601367 // upstream /// 152427 // Long QT syndrome-2 // 613688 // upstream /// 152427 // {Long QT syndrome-2, acquired, susceptibility to} // 613688 // upstream /// 152427 // Short QT syndrome-1 // 609620 // upstream /// 163729 // {Coronary artery spasm 1, susceptibility to} // --- // upstream /// 163729 // {Alzheimer disease, late-onset, susceptibility to} // 104300 // upstream /// 163729 // {Hypertension, susceptibility to} // 145500 // upstream /// 163729 // {Hypertension, pregnancy-induced} // 189800 // upstream /// 163729 // {Placental abruption} // --- // upstream /// 163729 // {Ischemic stroke, susceptibility to} // 601367 // upstream dbSNP RS ID: rs10277237
S-tag000009 rs4940383 18 46002758 + same 0 0 q21.1 CACTCATACCTCATAACAACCC[A/G]TAAGTACAGAGGTACGAAGG A G YES 6 3 A // 19.0000 /// local // 0.4639 --- deCODE // 68.8946 // 85.1392 // 52.6600 /// Marshfield // 68.5668 // 89.3886 // 48.5600 /// SLM1 // 69.1545 // 75.4487 // 63.2434 D18S455 // downstream // 81054 /// D18S450 // upstream // 42225 ENST00000256413 // upstream // 62659 // Hs.145230 // CTIF // 9811 // CBP80/20-dependent translation initiation factor /// ENST00000364002 // upstream // 787 // --- // --- // --- // --- /// NM_001039360 // upstream // 339078 // Hs.515388 // ZBTB7C // 201501 // zinc finger and BTB domain containing 7C /// NM_001142397 // upstream // 62669 // Hs.145230 // CTIF // 9811 // CBP80/20-dependent translation initiation factor --- dbSNP RS ID: rs4940383
S-tag000010 rs11779409 8 136597761 + same 0 0 q24.23 TCACCTTTTTATTCCCAATAACTA[A/G]TATATAATGTCTGGCACATAGTA A G YES 6 0 A // 14.0000 /// local // 0.4160 --- deCODE // 148.3495 // 195.7790 // 100.9163 /// Marshfield // 153.6283 // 209.2700 // 98.4539 /// SLM1 // 138.1180 // 170.7180 // 108.4690 D8S2049 // downstream // 23734 /// D5S1940 // upstream // 38127 ENST00000355849 // intron // 0 // Hs.444558 // KHDRBS3 // 10656 // KH domain containing, RNA binding, signal transduction associated 3 /// ENST00000517859 // intron // 0 // Hs.444558 // KHDRBS3 // 10656 // KH domain containing, RNA binding, signal transduction associated 3 /// ENST00000520981 // intron // 0 // Hs.444558 // KHDRBS3 // 10656 // KH domain containing, RNA binding, signal transduction associated 3 /// ENST00000522079 // intron // 0 // Hs.444558 // KHDRBS3 // 10656 // KH domain containing, RNA binding, signal transduction associated 3 /// ENST00000524199 // intron // 0 // Hs.444558 // KHDRBS3 // 10656 // KH domain containing, RNA binding, signal transduction associated 3 /// ENST00000524282 // intron // 0 // Hs.444558 // KHDRBS3 // 10656 // KH domain containing, RNA binding, signal transduction associated 3 /// NM_006558 // intron // 0 // Hs.444558 // KHDRBS3 // 10656 // KH domain containing, RNA binding, signal transduction associated 3 --- dbSNP RS ID: rs11779409
S-tag000012 rs7425967 2 228254536 + same 0 0 q36.3 AGAACATCTAGCCATAATACAA[C/T]AGTGATTAAATTCAGCTGTCTT T C --- 6 0 A // 14.0000 /// local // 0.4005 Variation_103424 // 2:228243310-228258857 // Affymetrix Human SNP array 6.0 and Illumina Human 1M BeadChip // 20811451 // Altshuler et al. (2010) // CopyNumber /// Variation_50408 // 2:228244397-228258288 // Illumina HumanHap550 V1 BeadChip // 19592680 // Shaikh et al. (2009) // CopyNumber /// Variation_63319 // 2:228241147-228258447 // Agilent custom oligo CGH array // 19812545 // Conrad et al. (2009) // CopyNumber /// Variation_9442 // 2:228244397-228258288 // Illumina HumanHap550 BeadChip // 17921354 // Wang et al. (2007) // CopyNumber deCODE // 230.6684 // 300.6968 // 160.6400 /// Marshfield // 229.1356 // 294.7716 // 164.0112 /// SLM1 // 212.7348 // 258.3403 // 167.3265 D2S2842 // downstream // 32203 /// D2S401 // upstream // 3594 ENST00000409979 // upstream // 82332 // Hs.352962 // AGFG1 // 3267 // ArfGAP with FG repeats 1 /// ENST00000449706 // upstream // 7825 // Hs.156652 // TM4SF20 // 79853 // transmembrane 4 L six family member 20 /// NM_024795 // upstream // 10514 // Hs.156652 // TM4SF20 // 79853 // transmembrane 4 L six family member 20 /// NR_049888 // upstream // 82312 // --- // MIR5703 // 100847081 // microRNA 5703 --- dbSNP RS ID: rs7425967
S-tag000014 rs4685575 3 2924686 - reverse 0 0 p26.2 CATTTAAAGCAGGTCCTATCTC[C/T]AGCAGTCATGAATTGTGGC T C YES 6 0 A // 18.0000 /// local // 0.3940 Variation_5211 // 3:2142080-3356591 // Illumina HumanHap300 BeadChip // 17116639 // Simon-Sanchez et al. (2007) // CopyNumber /// Variation_53518 // 3:2309379-2952214 // Illumina HumanHap300, Illumina HumanHap240S, Illumina HumanHap650Y, Illumina HumanHap550 BeadChips // 19166990 // Itsara et al. (2009) // CopyNumber /// Variation_8407 // 3:2242441-3220570 // Affymetrix 500K SNP Mapping Array // 17911159 // Pinto et al. (2007) // CopyNumber deCODE // 7.6712 // 3.1461 // 12.1964 /// Marshfield // 11.7554 // 4.5984 // 18.6096 /// SLM1 // 11.4212 // 3.9803 // 19.6424 D3S4051 // downstream // 131684 /// D3S2358 // upstream // 34687 ENST00000358480 // intron // 0 // Hs.298705 // CNTN4 // 152330 // contactin 4 /// ENST00000397461 // intron // 0 // Hs.298705 // CNTN4 // 152330 // contactin 4 /// ENST00000418658 // intron // 0 // Hs.298705 // CNTN4 // 152330 // contactin 4 /// ENST00000427331 // intron // 0 // Hs.298705 // CNTN4 // 152330 // contactin 4 /// ENST00000427741 // intron // 0 // Hs.298705 // CNTN4 // 152330 // contactin 4 /// ENST00000430505 // intron // 0 // Hs.298705 // CNTN4 // 152330 // contactin 4 /// ENST00000438282 // intron // 0 // Hs.298705 // CNTN4 // 152330 // contactin 4 /// ENST00000473058 // intron // 0 // Hs.298705 // CNTN4 // 152330 // contactin 4 /// ENST00000473173 // exon // 0 // Hs.298705 // CNTN4 // 152330 // contactin 4 /// NM_001206955 // intron // 0 // Hs.298705 // CNTN4 // 152330 // contactin 4 /// NM_175607 // intron // 0 // Hs.298705 // CNTN4 // 152330 // contactin 4 --- dbSNP RS ID: rs4685575
S-tag000016 rs193256295 10 104353108 - reverse 0 0 q24.32 AAAGGAGAAAACCAAGGCC[C/T]GAGCAACTCAAGATGTGTCC T C --- 6 3 A // 19.0000 /// local // 0.4918 --- deCODE // 122.2013 // 158.8115 // 85.5910 /// Marshfield // 124.7707 // 158.4685 // 91.8191 /// SLM1 // 117.5215 // 136.1087 // 99.0868 D10F2861E // downstream // 113744 /// D10S1697 // upstream // 18688 ENST00000369899 // intron // 0 // Hs.404089 // SUFU // 51684 // suppressor of fused homolog (Drosophila) /// ENST00000369902 // intron // 0 // Hs.404089 // SUFU // 51684 // suppressor of fused homolog (Drosophila) /// ENST00000423559 // intron // 0 // Hs.404089 // SUFU // 51684 // suppressor of fused homolog (Drosophila) /// ENST00000471000 // intron // 0 // Hs.404089 // SUFU // 51684 // suppressor of fused homolog (Drosophila) /// NM_001178133 // intron // 0 // Hs.404089 // SUFU // 51684 // suppressor of fused homolog (Drosophila) /// NM_016169 // intron // 0 // Hs.404089 // SUFU // 51684 // suppressor of fused homolog (Drosophila) 607035 // Medulloblastoma, desmoplastic // 155255 // intron /// 607035 // {Meningioma, familial, susceptibility to} // 607174 // intron dbSNP RS ID: rs193256295
S-tag000017 rs9379692 6 24809771 - reverse 0 0 p22.3 ACGAAGAACTGATCAGTGTC[C/T]ATCTCACCCCAACTCCTTG T C YES 6 3 A // 19.0000 /// local // 0.4140 Variation_36499 // 6:24774149-24824012 // Paired End Mapping // 18451855 // Kidd et al. (2008) // CopyNumber deCODE // 48.8012 // 53.4032 // 44.1998 /// Marshfield // 42.2127 // 46.5627 // 38.0244 /// SLM1 // 47.8161 // 50.7322 // 46.4768 D6S2297 // downstream // 38079 /// D6S2235 // upstream // 27176 ENST00000259698 // intron // 0 // Hs.559459 // FAM65B // 9750 // family with sequence similarity 65, member B /// ENST00000538035 // intron // 0 // Hs.559459 // FAM65B // 9750 // family with sequence similarity 65, member B /// NM_014722 // intron // 0 // Hs.559459 // FAM65B // 9750 // family with sequence similarity 65, member B --- dbSNP RS ID: rs9379692
S-tag000020 rs11133011 4 174580215 + same 0 0 q34.1 AGAAGGACGTTCTATAATCTCT[C/T]ACTGCATGCAGACATAAAGC T C YES 6 3 A // 17.0000 /// local // 0.3905 --- deCODE // 168.1134 // 220.2100 // 116.0269 /// Marshfield // 175.0634 // 233.2754 // 117.6400 /// SLM1 // 167.3463 // 215.4463 // 121.2000 D4S3234 // downstream // 6793 /// D4S2343 // upstream // 124252 ENST00000413691 // upstream // 24693 // --- // --- // --- // --- /// ENST00000515825 // downstream // 218407 // --- // --- // --- // --- /// NM_012180 // downstream // 577595 // Hs.76917 // FBXO8 // 26269 // F-box protein 8 /// NR_003679 // downstream // 117234 // --- // NBLA00301 // 79804 // Nbla00301 --- dbSNP RS ID: rs11133011
S-tag000026 rs1274264 3 114353990 + same 0 0 q13.31 CTGAGGGATAGTTAGCAAAAA[A/C]TAAAAGGAGCAGGCATCC A C YES 6 3 A // 17.0000 /// local // 0.3652 --- deCODE // 122.1371 // 154.2233 // 90.0581 /// Marshfield // 129.0749 // 156.3710 // 102.0892 /// SLM1 // 117.4833 // 133.8237 // 102.0000 D3S2767E // downstream // 51920 /// D3S3526 // upstream // 131248 ENST00000357258 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// ENST00000462705 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// ENST00000463890 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// ENST00000464560 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// ENST00000471418 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// ENST00000479879 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// ENST00000480832 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// ENST00000491500 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// ENST00000492665 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// NM_001164343 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// NM_001164344 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// NM_001164345 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// NM_015642 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 --- dbSNP RS ID: rs1274264
S-tag000028 rs10165364 2 213398277 - reverse 0 0 q34 GTTTCCTGAAACTGTATGTCTT[C/T]AACATAATTTGAGGGAGACTTTA T C --- 6 0 A // 15.0000 /// local // 0.3518 --- deCODE // 208.7744 // 271.4507 // 146.1057 /// Marshfield // 208.4201 // 266.9680 // 150.1500 /// SLM1 // 194.9766 // 233.9101 // 155.6956 D2S1749 // downstream // 649008 /// D2S317 // upstream // 103277 ENST00000260943 // intron // 0 // Hs.390729 // ERBB4 // 2066 // v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) /// ENST00000342788 // intron // 0 // Hs.390729 // ERBB4 // 2066 // v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) /// ENST00000402597 // intron // 0 // Hs.390729 // ERBB4 // 2066 // v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) /// ENST00000436443 // intron // 0 // Hs.390729 // ERBB4 // 2066 // v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) /// ENST00000484594 // intron // 0 // Hs.390729 // ERBB4 // 2066 // v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) /// NM_001042599 // intron // 0 // Hs.390729 // ERBB4 // 2066 // v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) /// NM_005235 // intron // 0 // Hs.390729 // ERBB4 // 2066 // v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) --- dbSNP RS ID: rs10165364
S-tag000029 rs357210 1 72025716 - reverse 0 0 p31.1 TCTGTGTAGTTGACAATCATGT[A/G]CACTAGACTTCAAGTGAAGATG A G YES 6 3 A // 17.0000 /// local // 0.3589 --- deCODE // 99.1537 // 128.9413 // 69.3583 /// Marshfield // 100.1804 // 134.4389 // 66.3000 /// SLM1 // 91.4481 // 109.2963 // 73.3481 D80032 // downstream // 157091 /// D1S224 // upstream // 114470 ENST00000306821 // intron // 0 // Hs.146542 // NEGR1 // 257194 // neuronal growth regulator 1 /// ENST00000357731 // intron // 0 // Hs.146542 // NEGR1 // 257194 // neuronal growth regulator 1 /// ENST00000434200 // intron // 0 // Hs.146542 // NEGR1 // 257194 // neuronal growth regulator 1 /// NM_173808 // intron // 0 // Hs.146542 // NEGR1 // 257194 // neuronal growth regulator 1 --- dbSNP RS ID: rs357210
S-tag000031 rs17807807 11 84291404 - reverse 0 0 q14.1 CTGTAAGTACAAGTCAAAGAGT[C/T]AGCAATTTGTTTGGAGACTG T C YES 6 3 A // 16.0000 /// local // 0.3658 --- deCODE // 89.9646 // 120.6258 // 59.3015 /// Marshfield // 86.9967 // 105.2569 // 67.4000 /// SLM1 // 76.9340 // 97.3055 // 57.3000 D11S4135 // downstream // 30417 /// D11S1207 // upstream // 1574 ENST00000376104 // intron // 0 // Hs.367656 // DLG2 // 1740 // discs, large homolog 2 (Drosophila) /// ENST00000398309 // intron // 0 // Hs.367656 // DLG2 // 1740 // discs, large homolog 2 (Drosophila) /// ENST00000524982 // intron // 0 // Hs.367656 // DLG2 // 1740 // discs, large homolog 2 (Drosophila) /// ENST00000527088 // intron // 0 // Hs.367656 // DLG2 // 1740 // discs, large homolog 2 (Drosophila) /// ENST00000529111 // intron // 0 // Hs.367656 // DLG2 // 1740 // discs, large homolog 2 (Drosophila) /// ENST00000532653 // intron // 0 // Hs.367656 // DLG2 // 1740 // discs, large homolog 2 (Drosophila) /// ENST00000543673 // intron // 0 // Hs.367656 // DLG2 // 1740 // discs, large homolog 2 (Drosophila) /// ENST00000546021 // intron // 0 // Hs.367656 // DLG2 // 1740 // discs, large homolog 2 (Drosophila) /// NM_001142699 // intron // 0 // Hs.367656 // DLG2 // 1740 // discs, large homolog 2 (Drosophila) /// NM_001364 // intron // 0 // Hs.367656 // DLG2 // 1740 // discs, large homolog 2 (Drosophila) --- dbSNP RS ID: rs17807807
S-tag000034 rs4789412 17 75071134 + same 0 0 q25.2 AGAGTCACTGCAAGATCAC[A/G]TTTGGGAGGATGGGAATTTATC A G YES 6 3 A // 18.0000 /// local // 0.5035 --- deCODE // 117.3484 // 151.0180 // 83.6789 /// Marshfield // 104.6598 // 136.4455 // 73.9948 /// SLM1 // 101.0494 // 120.8494 // 82.9224 D17S2241 // downstream // 43813 /// D17S2242 // upstream // 53284 ENST00000366146 // downstream // 5584 // --- // --- // --- // --- /// ENST00000428789 // downstream // 124669 // Hs.144531 // MGAT5B // 146664 // mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B /// NM_198955 // downstream // 124663 // Hs.144531 // MGAT5B // 146664 // mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B /// NR_027058 // upstream // 13591 // --- // LINC00338 // 654434 // long intergenic non-protein coding RNA 338 --- dbSNP RS ID: rs4789412
S-tag000035 rs10951343 7 32634796 + same 0 0 p14.3 GTGCAGAGTAAGCACTTAG[C/T]GGACACTGGATGAATAGACCG T C YES 6 3 A // 20.0000 /// local // 0.4077 --- deCODE // 53.1720 // 61.9918 // 44.3437 /// Marshfield // 50.6504 // 54.7401 // 46.7007 /// SLM1 // 44.9255 // 50.9000 // 38.7509 D7S1655 // downstream // 7558 /// D7S3239 // upstream // 15574 ENST00000404479 // intron // 0 // Hs.128056 // AVL9 // 23080 // AVL9 homolog (S. cerevisiase) /// NR_036680 // intron // 0 // --- // DPY19L1P1 // 100129460 // dpy-19-like 1 pseudogene 1 (C. elegans) --- dbSNP RS ID: rs10951343
S-tag000036 rs9454688 6 69796984 - reverse 0 0 q12 AGTGTAGGCTCAAGTTAGAA[A/C]GTGTAAAGGATCTATATGTGTGT A C YES 6 3 A // 16.0000 /// local // 0.3528 --- deCODE // 83.8107 // 108.2814 // 59.3400 /// Marshfield // 83.1762 // 109.6708 // 57.6894 /// SLM1 // 80.3987 // 97.0000 // 64.4127 D6S965 // downstream // 47133 /// D6S467 // upstream // 128319 ENST00000370598 // intron // 0 // Hs.13261 // BAI3 // 577 // brain-specific angiogenesis inhibitor 3 /// NM_001704 // intron // 0 // Hs.13261 // BAI3 // 577 // brain-specific angiogenesis inhibitor 3 --- dbSNP RS ID: rs9454688

Total number of rows: 239038

Table truncated, full table size 254800 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap