GEO DataSets

Part of a comparison of spotted long oligonucleotide arrays with in situ synthesized 25-mer arrays. Examination of amplified and unamplified K562 erythroleukemia RNA and Stratagene Universal Human Reference RNA.

Organism:

Homo sapiens

Type:

Expression profiling by array, log ratio, 3 protocol sets

Platform:

GPL273

Series:

GSE344

14 Samples

Download data

(Submitter supplied) Both spotted long oligonucleotide arrays and Affymetrix GeneChips were used to measure differential gene expression in two RNA samples (K562 erythroleukemia RNA and the Stratagene Universal Human Reference RNA). For Affymetrix technology, the two RNAs were analyzed separately. There are two replicates for K562 RNA (GSM4843 and GSM4844) and three for the Stratagene Universal reference (GSM4845-GSM4847). more...

Organism:

Homo sapiens

Type:

Expression profiling by array

Datasets:

GDS222 GDS223

Platforms:

GPL273 GPL8300 GPL274

23 Samples

Download data: CEL

Part of a comparison of spotted long oligonucleotide arrays with in situ synthesized 25-mer arrays. Examination of amplified and unamplified K562 erythroleukemia RNA and Stratagene Universal Human Reference RNA.

Organism:

Homo sapiens

Type:

Expression profiling by array, transformed count, 2 cell type sets

Platform:

GPL8300

Series:

GSE344

5 Samples

Download data: CEL

(Submitter supplied) Transcriptional profiling of six bovine tissues (small intestine, spleen, liver, adrenal gland, anterior pituitary, and thymus). Samples collected from each of 6 Angus steers at 14 months of age. Experiment was duplicated at two locations to measure reproducability of results.

Organism:

Bos taurus

Type:

Expression profiling by array

Platform:

GPL8813

144 Samples

Download data

(Submitter supplied) Both spotted long oligonucleotide arrays (GPL1384) and Affymetrix GeneChip arrays (GPL96) were used to analyze gene expression in six human head and neck squamous cell carinoma samples versus control samples or lymph node metastases of the same patients. Hybridizations of HG-U133A GeneChip arrays were performed using standard Affymetrix protocols and equipment. Before hybridization on DKFZ Operon 27k long oligonucleotide arrays, 2 µg RNA were amplified by one round of linear isothermal RNA amplification, followed by Cy-dUTP incorporation using Klenow fragment. more...

Organism:

Homo sapiens

Type:

Expression profiling by array

Platforms:

GPL1384 GPL96

24 Samples

Download data: CEL, TIFF

(Submitter supplied) 25x75 mm in dimension. Protocol: 21K 60-mer oligo probes were designed from the MaizeGDB EST contigs and synthesized in situ by an ink-jet printing method employing standard phosphoramidite chemistry on glass slides.

Organism:

Zea mays

1 Series

24 Samples

Download data

(Submitter supplied) This SuperSeries is composed of the SubSeries listed below.

Organism:

Mus musculus

Type:

Expression profiling by array

Platform:

GPL208

6 Samples

Download data

(Submitter supplied) Replicate hybridizations using mouse spleen mRNA Keywords: repeat sample

Organism:

Mus musculus

Type:

Expression profiling by array

Platform:

GPL208

3 Samples

Download data

(Submitter supplied) Replicate hydridizations with mouse liver mRNA. Keywords: repeat sample

Organism:

Mus musculus

Type:

Expression profiling by array

Platform:

GPL208

3 Samples

Download data

(Submitter supplied) DNA Microarray construction : Gene expression analyses were carried out using home-made Nylon microarrays using a previously described technology [10441335]. These microarrays were built using as templates cDNA clones provided by the INRA-AGENAE program [16887034]. All these clones were PCR-amplified at the INRA Resources Centre for Animal Genomics (CRB GADIE, Jouy en Josas, France) using primers designed on the plasmid sequences flanking the cDNA inserts (M13RP1 5’- GTGGAATTGTGAGCGGATAAC and M13RP2 5’-GCAAGGCGATTAAGTTGGG). more...

Organism:

Oncorhynchus mykiss

1 Series

40 Samples

Download data

(Submitter supplied) Both in situ synthesized long oligo arrays from Agilent Technologies and short oligo arrays from Affymetrix were used to meausre differential gene expression in RNA samples generated from (1) human neural stem cells treated with vehicle (EtOH, 0.01%) and tert-butylhydroquinone (tBHQ, 20µM) for 24h, and (2) neuroblastoma cells treated with vehicle (EtOH, 0.01%) and tert-butylhydroquinone (tBHQ, 10µM) for 24h. more...

Organism:

Homo sapiens

Type:

Expression profiling by array

Platforms:

GPL8300 GPL885

20 Samples

Download data

(Submitter supplied) Nonhuman primates including African Green Monkey (AGM) are important models for biomedical research. The information on monkey genomes is still limited and no versatile gene expression screening tool is available. We tested human whole genome microarrays for cross-species reactivity with AGM transcripts using both long oligonucleotide arrays (60-mer probes, Applied Biosystems-ABI) and short oligonucleotide arrays (25-mer, Affymetrix). more...

Organism:

Macaca mulatta; Homo sapiens; Chlorocebus sabaeus

Type:

Expression profiling by array

Platforms:

GPL1426 GPL2986 GPL570

14 Samples

Download data: CEL, EXP, TXT

(Submitter supplied) This array is a Listeria monocytogenes pan-genome tiling array covering the full genomes of 20 L. monocytogenes strains. Each probe on the array may target multiple strains. Each probe may contain either zero or one mismatch to its intended genomic targets. The whole genomes of all 20 strains are tiled at an average depth of coverage of 2.65x, and the 50-mer probes are offset on average 21 bp from one another. more...

Organism:

Listeria monocytogenes; Listeria monocytogenes EGD-e; Listeria monocytogenes serotype 4b str. F2365; Listeria monocytogenes serotype 1/2a str. F6854; Listeria monocytogenes serotype 4b str. H7858; Listeria monocytogenes FSL F2-515; Listeria monocytogenes FSL J1-194; Listeria monocytogenes FSL J1-175; Listeria monocytogenes FSL J1-208; Listeria monocytogenes FSL J2-003; Listeria monocytogenes FSL J2-071; Listeria monocytogenes FSL J2-064; Listeria monocytogenes FSL N1-017; Listeria monocytogenes FSL N3-165; Listeria monocytogenes FSL R2-503; Listeria monocytogenes F6900; Listeria monocytogenes J0161; Listeria monocytogenes J2818; Listeria monocytogenes LO28; Listeria monocytogenes 10403S; Listeria monocytogenes HPB2262

1 Series

18 Samples

Download data: NDF, POS, TXT

(Submitter supplied) Background:Alternative splicing and isoform level expression profiling is an emerging field of interest within genomics. Splicing sensitive microarrays, with probes targeted to individual exons or exon-junctions, are becoming increasingly popular as a tool capable of both expression profiling and finer scale isoform detection. Despite their intuitive appeal, relatively little is known about the performance of such tools, particularly in comparison with more traditional 3’ targeted microarrays. more...

Organism:

Homo sapiens

Type:

Expression profiling by array

Platforms:

GPL5175 GPL5188

40 Samples

Download data: CEL

(Submitter supplied) Background:Alternative splicing and isoform level expression profiling is an emerging field of interest within genomics. Splicing sensitive microarrays, with probes targeted to individual exons or exon-junctions, are becoming increasingly popular as a tool capable of both expression profiling and finer scale isoform detection. Despite their intuitive appeal, relatively little is known about the performance of such tools, particularly in comparison with more traditional 3’ targeted microarrays. more...

Organism:

Homo sapiens

Type:

Expression profiling by array

Platform:

GPL5188

20 Samples

Download data: CEL

(Submitter supplied) Background:Alternative splicing and isoform level expression profiling is an emerging field of interest within genomics. Splicing sensitive microarrays, with probes targeted to individual exons or exon-junctions, are becoming increasingly popular as a tool capable of both expression profiling and finer scale isoform detection. Despite their intuitive appeal, relatively little is known about the performance of such tools, particularly in comparison with more traditional 3’ targeted microarrays. more...

Organism:

Homo sapiens

Type:

Expression profiling by array

Platform:

GPL5175

20 Samples

Download data: CEL

(Submitter supplied) E12.5 mouse whole embryos and placentas were pooled within 3 litters and total RNA was extracted. Fluorescently-labeled, linearly-amplified cRNA targets were prepared from the RNA samples and compared on a novel microarray design to validate the system. A "dye-swapped" experimental design was used to assess the accuracy and precision of the system. The in situ-synthesized 60-mer oligonucleotide microarray platform contains approximately 22,000 DNA features, and was designed to detect transcripts from the entire NIA cDNA clone collection. more...

Organism:

Mus musculus

Type:

Expression profiling by array

Platform:

GPL870

6 Samples

Download data

(Submitter supplied) E12.5 mouse whole embryos and placentas were pooled within 3 litters and total RNA was extracted. Fluorescently-labeled, linearly-amplified cRNA targets were prepared from the RNA samples and compared on a novel microarray design to validate the system. A "self-versus-self" experimental design was used to assess the false-positive rates in the system. The in situ-synthesized 60-mer oligonucleotide microarray platform contains approximately 22,000 DNA features, and was designed to detect transcripts from the entire NIA cDNA clone collection. more...

Organism:

Mus musculus

Type:

Expression profiling by array

Platform:

GPL870

6 Samples

Download data

(Submitter supplied) E12.5 mouse whole embryos and placentas were pooled within 3 litters and total RNA was extracted. Fluorescently-labeled, linearly-amplified cRNA targets were prepared from the RNA samples at various input levels. A "full-scale" reference was prepared using the standard input level of 6.0 ug total RNA, and one round of amplification was performed with 250 ng and 50 ng total RNA inputs. For 10 ng and 2 ng inputs, two rounds of amplification were used. more...

Organism:

Mus musculus

Type:

Expression profiling by array

Platform:

GPL870

8 Samples

Download data

(Submitter supplied) Recently, long oligonucleotide (60-70mer) microarrays for two-color experiments have been developed and are gaining widespread use. In addition, when there is limited availability of mRNA from tissue sources, RNA amplification can and is being used to produce sufficient quantities of cRNA for microarray hybridization. Taking advantage of the selective degradation of RNA under alkaline conditions, we have developed a method to “strip” glass-based oligonucleotide microarrays that use fluorescent RNA in the hybridization, while leaving the DNA oligonucleotide probes intact and usable for a second experiment. more...

Organism:

Homo sapiens

Type:

Expression profiling by array

Platforms:

GPL1390 GPL885 GPL887

20 Samples

Download data