nsv6314388
- Organism: Homo sapiens
- Study:nstd102 (Clinical Structural Variants)
- Variant Type:delins
- Method Type:Multiple
- Submitted on:GRCh37, GRCh38
- Variant Calls:1
- Validation:Not tested
- Clinical Assertions: Yes
- Region Size:10
- Description:NM_033629.6(TREX1):c.858_867delinsTGGATGCTCACG
CCAGGCCTTTCGGCACCATCAGGCCCATGTATGGGGTCACAGCCTCTGCTAGGACCAA
GCCAAGACCATCTGCTGTCACAACCACTGCACACCTGGCCACAACCAGGAACACTAGT
CCCAGCCTTGGAGAGAGCAGGGGTACCAAGGATCTTCCTCCAGTGAAGGACCCTGGAG
CCCTAT (p.Leu287_Ala289delinsGlyCysSerArgGlnAlaPheA
rgHisHisGlnAlaHisValTrpGlyHisSerLeuCysTer) AND multiple conditions - Publication(s):Crow et al. 2005, de Boer et al. 2019
- ClinVar: RCV002051312.2
- ClinVar: VCV001350376.3
- GeneReviews: NBK1475
- GeneReviews: NBK546576
- MONDO: 0008641
- MONDO: 0009165
- MONDO: 0012500
- MedGen: C0024145
- MedGen: C0796126
- MedGen: C1860518
- OMIM: 192315
- OMIM: 225750
- OMIM: 610448
- Orphanet: 3421
- Orphanet: 51
- Orphanet: 63261
- Orphanet: 71291
- PubMed: 20301648
- PubMed: 31536185
- Overlapping Genes
Source: NCBI
- Genome View
- Variant Region Details and Evidence
- Validation Information
- Clinical Assertions
- Genotype Information
Genome View
Select assembly:Overlapping variant regions from other studies: 88 SVs from 25 studies. See in: genome view
Overlapping variant regions from other studies: 88 SVs from 25 studies. See in: genome view
Variant Region Placement Information
| Variant Region ID | Placement Type | Assembly | Assembly Unit | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nsv6314388 | Submitted genomic | GRCh38 (hg38) | Primary Assembly | NC_000003.12 | Chr3 | 48,467,513 | 48,467,522 |
| nsv6314388 | Submitted genomic | GRCh37 (hg19) | Primary Assembly | NC_000003.11 | Chr3 | 48,508,912 | 48,508,921 |
Variant Call Information
| Variant Call ID | Type | Method | Analysis | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv17974022 | delins | Multiple | Multiple | AICARDI-GOUTIERES SYNDROME 1; AGS1; Aicardi Goutieres syndrome 1; Aicardi-Goutières Syndrome; Aicardi-Goutières syndrome; CHILBLAIN LUPUS 1; CHBL1; Cerebroretinal vasculopathy; Chilblain lupus 1; HERNS syndrome; Hereditary vascular retinopathy; Retinal Vasculopathy with Cerebral Leukoencephalopathy and Systemic Manifestations; VASCULOPATHY, RETINAL, WITH CEREBRAL LEUKODYSTROPHY; RVCL; Vasculopathy, retinal, with cerebral leukodystrophy | Uncertain significance | ClinVar | RCV002051312.2, VCV001350376.3 |
Variant Call Placement Information
| Variant Call ID | Placement Type | HGVS | Assembly | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nssv17974022 | Submitted genomic | NC_000003.12:g.484 67513_48467522deli ns192 | GRCh38 (hg38) | NC_000003.12 | Chr3 | 48,467,513 | 48,467,522 |
| nssv17974022 | Submitted genomic | NC_000003.11:g.485 08912_48508921deli ns192 | GRCh37 (hg19) | NC_000003.11 | Chr3 | 48,508,912 | 48,508,921 |
No validation data were submitted for this variant
Clinical Assertions
| Variant Call ID | HGVS | Type | Allele Origin | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv17974022 | GRCh37: NC_000003.11:g.48508912_48508921delins192, GRCh38: NC_000003.12:g.48467513_48467522delins192 | delins | germline | AICARDI-GOUTIERES SYNDROME 1; AGS1; Aicardi Goutieres syndrome 1; Aicardi-Goutières Syndrome; Aicardi-Goutières syndrome; CHILBLAIN LUPUS 1; CHBL1; Cerebroretinal vasculopathy; Chilblain lupus 1; HERNS syndrome; Hereditary vascular retinopathy; Retinal Vasculopathy with Cerebral Leukoencephalopathy and Systemic Manifestations; VASCULOPATHY, RETINAL, WITH CEREBRAL LEUKODYSTROPHY; RVCL; Vasculopathy, retinal, with cerebral leukodystrophy | Uncertain significance | ClinVar | RCV002051312.2, VCV001350376.3 |