nsv5674255
- Organism: Homo sapiens
- Study:nstd102 (Clinical Structural Variants)
- Variant Type:insertion
- Method Type:Multiple
- Submitted on:GRCh37, GRCh38
- Variant Calls:1
- Validation:Not tested
- Clinical Assertions: Yes
- Region Size:1
- Description:NC_000011.9:g.108141788_108141789insAGTATCTAAT
GCTTTTTTTTTTTTTTTTTTTTTTGANNNNNNNNNNTAGAGACGGGGTTTCACCGTTT
TAGCCGGGATGGTCTCGATCTCCTGACCTCGTGATCCGCCCGCCTCGGCCTCCCAAAG
TGCTGGGATTACAGGCGTGAGCCACCGCGCCCGGCC AND Ataxia-telangiectasia syndrome - Publication(s):Bird et al. 1998, Gasser et al. 2009, Gatti et al. 1999, van de Warrenburg et al. 2014
- Genome View
- Variant Region Details and Evidence
- Validation Information
- Clinical Assertions
- Genotype Information
Genome View
Select assembly:Overlapping variant regions from other studies: 99 SVs from 19 studies. See in: genome view
Overlapping variant regions from other studies: 99 SVs from 19 studies. See in: genome view
Variant Region Placement Information
| Variant Region ID | Placement Type | Assembly | Assembly Unit | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nsv5674255 | Submitted genomic | GRCh38 (hg38) | Primary Assembly | NC_000011.10 | Chr11 | 108,271,061 | 108,271,061 |
| nsv5674255 | Submitted genomic | GRCh37 (hg19) | Primary Assembly | NC_000011.9 | Chr11 | 108,141,788 | 108,141,788 |
Variant Call Information
| Variant Call ID | Type | Method | Analysis | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv17172958 | insertion | Multiple | Multiple | ATAXIA-TELANGIECTASIA; AT; Ataxia-Telangiectasia; Ataxia-telangiectasia; Ataxia-telangiectasia syndrome; See individual phenotypes in OMIM allelic variants | Pathogenic | ClinVar | RCV001386321.3, VCV001073340.3 |
Variant Call Placement Information
| Variant Call ID | Placement Type | HGVS | Assembly | Sequence ID | Chr | Start | Stop |
|---|---|---|---|---|---|---|---|
| nssv17172958 | Submitted genomic | NC_000011.10:g.108 271061_108271062in s162 | GRCh38 (hg38) | NC_000011.10 | Chr11 | 108,271,061 | 108,271,061 |
| nssv17172958 | Submitted genomic | NC_000011.9:g.1081 41788_108141789ins 162 | GRCh37 (hg19) | NC_000011.9 | Chr11 | 108,141,788 | 108,141,788 |
No validation data were submitted for this variant
Clinical Assertions
| Variant Call ID | HGVS | Type | Allele Origin | Subject Phenotype | Clinical Interpretation | Source of Interpretation | ClinVar ID |
|---|---|---|---|---|---|---|---|
| nssv17172958 | GRCh37: NC_000011.9:g.108141788_108141789ins162, GRCh38: NC_000011.10:g.108271061_108271062ins162 | insertion | germline | ATAXIA-TELANGIECTASIA; AT; Ataxia-Telangiectasia; Ataxia-telangiectasia; Ataxia-telangiectasia syndrome; See individual phenotypes in OMIM allelic variants | Pathogenic | ClinVar | RCV001386321.3, VCV001073340.3 |