Instrument: Illumina HiSeq 2000
Strategy: ncRNA-Seq
Source: TRANSCRIPTOMIC
Selection: size fractionation
Layout: SINGLE
Construction protocol: Total RNAs were extracted using mirVana miRNA Isolation Kit (ThermoFisher, AM1560). Genomic DNA was size selected using the Pippin HT DNA Size Selection System (Sage Science, Beverly, MA, USA). 1, Strand-specific RNA-seq: libraries were constructed following the TruSeq RNA sample preparation protocol. rRNAs were depleted from total RNAs by Ribo-Zero Gold (Epicentre Biotechnologies, Madison, WI, USA). 2, Small RNA-seq: Testes samples were lysed and treated with sodium periodate for library constrution. The 3'-adapter is TGGAATTCTCGGGTGCCAAGG and has been trimmed in the raw data. 1, Strand-specific RNA-seq; 2, Small RNA-seq