GEO Profiles Links for Nucleotide (Select 261862324) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 372

<< First< Prev

Page of 19

Next >Last >>

Select item 1194061341.

Armcx6 - Chronic, low level drug exposure effect on obese liver

Annotation:: Armcx6, armadillo repeat containing, X-linked 6

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P149364 (ID_REF), GDS5258, NM_001007578, A_52_P149364 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119406134

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 715419342.

Armcx6 - Interstrain differences in the liver effects of trichloroethylene

Annotation:: Armcx6, armadillo repeat containing, X-linked 6

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P149364 (ID_REF), GDS3890, NM_001007578, A_52_P149364 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 94 samples

ID:: 71541934

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 551947443.

Armcx6 - Iron enriched and deficient diets effect on the liver

Annotation:: Armcx6, armadillo repeat containing, X-linked 6

Organism:: Mus musculus

Reporter:: GPL4134, 22444 (ID_REF), GDS3373, NM_001007578, A_52_P149364 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 55194744

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1209187344.

Armcx6 - T helper type 9 cells

Annotation:: Armcx6, armadillo repeat containing, X-linked 6

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P149364 (ID_REF), GDS5291, NM_001007578, A_52_P149364 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 120918734

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 319012055.

Armcx6 - Resveratrol and high-fat high-calorie diet effect on liver

Annotation:: Armcx6, armadillo repeat containing, X-linked 6

Organism:: Mus musculus

Reporter:: GPL2872, 26805 (ID_REF), GDS2413, NM_001007578, A_52_P149364 (SPOT ID)

DataSet type:: Expression profiling by array, Z-score, 14 samples

ID:: 31901205

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1226729346.

Armcx6 - T helper type 9 cells stimulated with anti-CD3 antibody

Annotation:: Armcx6, armadillo repeat containing, X-linked 6

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P149364 (ID_REF), GDS5343, NM_001007578, A_52_P149364 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 122672934

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 650437447.

Armcx6 - Lean B6.C-D7Mit353 strain: various tissues

Annotation:: Armcx6, armadillo repeat containing, X-linked 6

Organism:: Mus musculus

Reporter:: GPL2995, 336152 (ID_REF), GDS3692, XM_204367, NM_001007578

DataSet type:: Expression profiling by array, count, 25 samples

ID:: 65043744

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1316434348.

Armcx6 - Normal liver developmental stages: embryonic and postnatal

Annotation:: Armcx6, armadillo repeat containing, X-linked 6

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P149364 (ID_REF), GDS5818, NM_001007578, A_52_P149364 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 11 samples

ID:: 131643434

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 455879019.

Armcx6 - Ultrafine particles effect on ovalbumin-sensitized lungs

Annotation:: Armcx6, armadillo repeat containing, X-linked 6

Organism:: Mus musculus

Reporter:: GPL4636, 5801 (ID_REF), GDS2976, XM_204367

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 45587901

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12786031710.

Armcx6 - Rhabdomyosarcoma model

Annotation:: Armcx6, armadillo repeat containing, X-linked 6

Organism:: Mus musculus

Reporter:: GPL6481, 101850136 (ID_REF), GDS5527, XM_204367, LOC278097 (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 127860317

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12889103711.

Armcx6 - Interferon-gamma effect on lipopolysaccharide-activated bone marrow-derived macrophages

Annotation:: Armcx6, armadillo repeat containing, X-linked 6

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_1228827 (ID_REF), GDS5623, XM_204367

DataSet type:: Expression profiling by array, transformed count, 15 samples

ID:: 128891037

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12889590512.

Armcx6 - Interferon-gamma effect on lipopolysaccharide-activated bone marrow-derived macrophages

Annotation:: Armcx6, armadillo repeat containing, X-linked 6

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3012253 (ID_REF), GDS5623, NM_001007578

DataSet type:: Expression profiling by array, transformed count, 15 samples

ID:: 128895905

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7539436513.

Armcx6 - Developing testis and ovary

Annotation:: Armcx6, armadillo repeat containing, X-linked 6

Organism:: Mus musculus

Reporter:: GPL6246, 10606730 (ID_REF), GDS3995, NM_001007578, BC027264, chrX:134748455-134751412 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 91 samples

ID:: 75394365

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7568761714.

Armcx6 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Armcx6, armadillo repeat containing, X-linked 6

Organism:: Mus musculus

Reporter:: GPL6481, 101850136 (ID_REF), GDS4002, XM_204367, LOC278097 (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75687617

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11527354415.

Armcx6 - Glucocorticoid effect on the male liver

Annotation:: Armcx6, armadillo repeat containing, X-linked 6

Organism:: Mus musculus

Reporter:: GPL4134, 22444 (ID_REF), GDS5035, NM_001007578, A_52_P149364 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115273544

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 763926716.

Armcx6 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Armcx6, armadillo repeat containing, X-linked 6

Organism:: Mus musculus

Reporter:: GPL1010, GATCTCCCTGTCTAAGCGCT (ID_REF), GDS878, NM_001007578

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7639267

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11675097217.

Armcx6 - Wig-1 depletion effect on brain striatum of mutant huntingtin transgenic animal

Annotation:: Armcx6, armadillo repeat containing, X-linked 6

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3012253 (ID_REF), GDS5185, NM_001007578, ARMCX6 (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 116750972

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12889590618.

Armcx6 - Interferon-gamma effect on lipopolysaccharide-activated bone marrow-derived macrophages

Annotation:: Armcx6, armadillo repeat containing, X-linked 6

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3082808 (ID_REF), GDS5623, NM_001007578

DataSet type:: Expression profiling by array, transformed count, 15 samples

ID:: 128895906

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10678406519.

Armcx6 - TGFβ inhibitor effect on induced cardiomyocytes

Annotation:: Armcx6, armadillo repeat containing, X-linked 6

Organism:: Mus musculus

Reporter:: GPL6246, 10606730 (ID_REF), GDS4898, NM_001007578, BC027264, chrX:134748455-134751412 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 27 samples

ID:: 106784065

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12229974420.

Armcx6 - Industrial pollution effect on liver

Annotation:: Armcx6, armadillo repeat containing, X-linked 6

Organism:: Mus musculus, Mus spretus

Reporter:: GPL4134, 22444 (ID_REF), GDS5331, NM_001007578, A_52_P149364 (SPOT ID)

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 122299744

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 19

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 261862324) (372)
GEO Profiles
Taxonomy Links for Nucleotide (Select 261862324) (1)
Taxonomy
Taxonomy Links for PopSet (Select 255709245) (44)
Taxonomy
Krynitzkia pustulata (15)
BioProject
Polypodiodes someyae (0)
Protein

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 372

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity