GEO Profile Links for Gene (Select 77911) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 14

Select item 971609781.

9230118H08Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: 9230118H08Rik, RIKEN cDNA 9230118H08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100085267_TGI_at (ID_REF), GDS4495, AK020356

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97160978

GEO DataSets Gene Profile neighbors

Select item 978739782.

9230118H08Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: 9230118H08Rik, RIKEN cDNA 9230118H08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100085267_TGI_at (ID_REF), GDS4527, AK020356

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97873978

GEO DataSets Gene Profile neighbors

Select item 499666883.

9230118H08Rik - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: 9230118H08Rik, RIKEN cDNA 9230118H08 gene

Organism:: Mus musculus

Reporter:: GPL1536, 1218476_1 (ID_REF), GDS3148, AK020356

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49966688

GEO DataSets Gene Profile neighbors

Select item 215745774.

9230118H08Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 9230118H08Rik, RIKEN cDNA 9230118H08 gene

Organism:: Mus musculus

Reporter:: GPL1942, 24577 (ID_REF), GDS1882, AK020356

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21574577

GEO DataSets Gene Profile neighbors

Select item 215745785.

9230118H08Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 9230118H08Rik, RIKEN cDNA 9230118H08 gene

Organism:: Mus musculus

Reporter:: GPL1942, 24578 (ID_REF), GDS1882, AK020356

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21574578

GEO DataSets Gene Profile neighbors

Select item 643617786.

9230118H08Rik - Hypertension model: aorta

Annotation:: 9230118H08Rik, RIKEN cDNA 9230118H08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100085267_TGI_at (ID_REF), GDS3672, AK020356

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64361778

GEO DataSets Gene Profile neighbors

Select item 76565087.

9230118H08Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: 9230118H08Rik, RIKEN cDNA 9230118H08 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCATCTCTCCAGCCCCCA (ID_REF), GDS878, AK020356

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7656508

GEO DataSets Gene

Select item 716836728.

9230118H08Rik - Fasting effect on multiple tissues: time course

Annotation:: 9230118H08Rik, RIKEN cDNA 9230118H08 gene

Organism:: Mus musculus

Reporter:: GPL11012, 18172 (ID_REF), GDS3893, AK020356

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71683672

GEO DataSets Gene

Select item 625608099.

9230118H08Rik - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: 9230118H08Rik, RIKEN cDNA 9230118H08 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl0077911.1_200-S (ID_REF), GDS3621, 9230118H08Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62560809

GEO DataSets Gene Profile neighbors

Select item 6448057810.

9230118H08Rik - Hypertension model: kidney

Annotation:: 9230118H08Rik, RIKEN cDNA 9230118H08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100085267_TGI_at (ID_REF), GDS3675, AK020356

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64480578

GEO DataSets Gene Profile neighbors

Select item 751880811.

9230118H08Rik - MPSS transcriptome analysis project

Annotation:: 9230118H08Rik, RIKEN cDNA 9230118H08 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCATCTCTCCAGCCCCCA (ID_REF), GDS868, AK020356

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7518808

GEO DataSets Gene

Select item 6440137812.

9230118H08Rik - Hypertension model: heart

Annotation:: 9230118H08Rik, RIKEN cDNA 9230118H08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100085267_TGI_at (ID_REF), GDS3673, AK020356

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64401378

GEO DataSets Gene Profile neighbors

Select item 6196040913.

9230118H08Rik - Eset depletion effect on embryonic stem cell

Annotation:: 9230118H08Rik, RIKEN cDNA 9230118H08 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl0077911.1_200-S (ID_REF), GDS3599, 9230118H08Rik (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61960409

GEO DataSets Gene Profile neighbors

Select item 6444097814.

9230118H08Rik - Hypertension model: liver

Annotation:: 9230118H08Rik, RIKEN cDNA 9230118H08 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100085267_TGI_at (ID_REF), GDS3674, AK020356

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64440978

GEO DataSets Gene Profile neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 77911) (14)
GEO Profiles
GEO Profile Links for Gene (Select 75023) (12)
GEO Profiles
Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), mem...
Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 [Mus musculus]
Gene ID:11987

Gene
11987[uid] AND (alive[prop]) (1)
Gene
Gm32486 predicted gene, 32486 [Mus musculus]
Gm32486 predicted gene, 32486 [Mus musculus]
Gene ID:102635051

Gene

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 14

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity