GEO Profile Links for Gene (Select 77761) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 14

Select item 215935211.

9230118N01Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 9230118N01Rik, RIKEN cDNA 9230118N01 gene

Organism:: Mus musculus

Reporter:: GPL1942, 43521 (ID_REF), GDS1882, AK020357

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21593521

GEO DataSets Gene Profile neighbors

Select item 716824292.

9230118N01Rik - Fasting effect on multiple tissues: time course

Annotation:: 9230118N01Rik, RIKEN cDNA 9230118N01 gene

Organism:: Mus musculus

Reporter:: GPL11012, 16929 (ID_REF), GDS3893, AK020357

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71682429

GEO DataSets Gene

Select item 644653583.

9230118N01Rik - Hypertension model: kidney

Annotation:: 9230118N01Rik, RIKEN cDNA 9230118N01 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100112159_TGI_at (ID_REF), GDS3675, AK020357

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64465358

GEO DataSets Gene Profile neighbors

Select item 499601824.

9230118N01Rik - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: 9230118N01Rik, RIKEN cDNA 9230118N01 gene

Organism:: Mus musculus

Reporter:: GPL1536, 1226239_1 (ID_REF), GDS3148, AK020357

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49960182

GEO DataSets Gene

Select item 215935205.

9230118N01Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 9230118N01Rik, RIKEN cDNA 9230118N01 gene

Organism:: Mus musculus

Reporter:: GPL1942, 43520 (ID_REF), GDS1882, AK020357

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21593520

GEO DataSets Gene Profile neighbors

Select item 625608116.

9230118N01Rik - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: 9230118N01Rik, RIKEN cDNA 9230118N01 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl4056.1.1_6-S (ID_REF), GDS3621, 9230118N01Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62560811

GEO DataSets Gene Profile neighbors

Select item 978587587.

9230118N01Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: 9230118N01Rik, RIKEN cDNA 9230118N01 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100112159_TGI_at (ID_REF), GDS4527, AK020357

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97858758

GEO DataSets Gene Profile neighbors

Select item 643861588.

9230118N01Rik - Hypertension model: heart

Annotation:: 9230118N01Rik, RIKEN cDNA 9230118N01 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100112159_TGI_at (ID_REF), GDS3673, AK020357

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64386158

GEO DataSets Gene Profile neighbors

Select item 644257589.

9230118N01Rik - Hypertension model: liver

Annotation:: 9230118N01Rik, RIKEN cDNA 9230118N01 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100112159_TGI_at (ID_REF), GDS3674, AK020357

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64425758

GEO DataSets Gene Profile neighbors

Select item 6434655810.

9230118N01Rik - Hypertension model: aorta

Annotation:: 9230118N01Rik, RIKEN cDNA 9230118N01 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100112159_TGI_at (ID_REF), GDS3672, AK020357

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64346558

GEO DataSets Gene

Select item 6196041111.

9230118N01Rik - Eset depletion effect on embryonic stem cell

Annotation:: 9230118N01Rik, RIKEN cDNA 9230118N01 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl4056.1.1_6-S (ID_REF), GDS3599, 9230118N01Rik (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61960411

GEO DataSets Gene Profile neighbors

Select item 9714575812.

9230118N01Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: 9230118N01Rik, RIKEN cDNA 9230118N01 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100112159_TGI_at (ID_REF), GDS4495, AK020357

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97145758

GEO DataSets Gene Profile neighbors

Select item 753181813.

9230118N01Rik - MPSS transcriptome analysis project

Annotation:: 9230118N01Rik, RIKEN cDNA 9230118N01 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTGTACATCATCGTCT (ID_REF), GDS868, AK020357

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7531818

GEO DataSets Gene

Select item 766951814.

9230118N01Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: 9230118N01Rik, RIKEN cDNA 9230118N01 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTGTACATCATCGTCT (ID_REF), GDS878, AK020357

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7669518

GEO DataSets Gene

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 77761) (14)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 14

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity