GEO Profile Links for Gene (Select 77726) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 14

Select item 716837861.

6030492E11Rik - Fasting effect on multiple tissues: time course

Annotation:: 6030492E11Rik, RIKEN cDNA 6030492E11 gene

Organism:: Mus musculus

Reporter:: GPL11012, 18286 (ID_REF), GDS3893, AK020086

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71683786

GEO DataSets Gene Profile neighbors

Select item 625597452.

6030492E11Rik - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: 6030492E11Rik, RIKEN cDNA 6030492E11 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl28604.1.1_315-S (ID_REF), GDS3621, 6030492E11Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62559745

GEO DataSets Gene Profile neighbors

Select item 619593453.

6030492E11Rik - Eset depletion effect on embryonic stem cell

Annotation:: 6030492E11Rik, RIKEN cDNA 6030492E11 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl28604.1.1_315-S (ID_REF), GDS3599, 6030492E11Rik (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61959345

GEO DataSets Gene Profile neighbors

Select item 499687174.

6030492E11Rik - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: 6030492E11Rik, RIKEN cDNA 6030492E11 gene

Organism:: Mus musculus

Reporter:: GPL1536, 1220180_1 (ID_REF), GDS3148, AK020086

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49968717

GEO DataSets Gene Profile neighbors

Select item 215906435.

6030492E11Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 6030492E11Rik, RIKEN cDNA 6030492E11 gene

Organism:: Mus musculus

Reporter:: GPL1942, 40643 (ID_REF), GDS1882, AK020086

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21590643

GEO DataSets Gene Profile neighbors

Select item 75302746.

6030492E11Rik - MPSS transcriptome analysis project

Annotation:: 6030492E11Rik, RIKEN cDNA 6030492E11 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCACTTATGGTCTGAAAT (ID_REF), GDS868, AK020086

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7530274

GEO DataSets Gene

Select item 215906427.

6030492E11Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 6030492E11Rik, RIKEN cDNA 6030492E11 gene

Organism:: Mus musculus

Reporter:: GPL1942, 40642 (ID_REF), GDS1882, AK020086

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21590642

GEO DataSets Gene Profile neighbors

Select item 643970838.

6030492E11Rik - Hypertension model: heart

Annotation:: 6030492E11Rik, RIKEN cDNA 6030492E11 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100089107_TGI_at (ID_REF), GDS3673, AK020086

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64397083

GEO DataSets Gene Profile neighbors

Select item 978696839.

6030492E11Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: 6030492E11Rik, RIKEN cDNA 6030492E11 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100089107_TGI_at (ID_REF), GDS4527, AK020086

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97869683

GEO DataSets Gene Profile neighbors

Select item 6435748310.

6030492E11Rik - Hypertension model: aorta

Annotation:: 6030492E11Rik, RIKEN cDNA 6030492E11 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100089107_TGI_at (ID_REF), GDS3672, AK020086

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64357483

GEO DataSets Gene Profile neighbors

Select item 6443668311.

6030492E11Rik - Hypertension model: liver

Annotation:: 6030492E11Rik, RIKEN cDNA 6030492E11 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100089107_TGI_at (ID_REF), GDS3674, AK020086

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64436683

GEO DataSets Gene Profile neighbors

Select item 9715668312.

6030492E11Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: 6030492E11Rik, RIKEN cDNA 6030492E11 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100089107_TGI_at (ID_REF), GDS4495, AK020086

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97156683

GEO DataSets Gene Profile neighbors

Select item 766797413.

6030492E11Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: 6030492E11Rik, RIKEN cDNA 6030492E11 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCACTTATGGTCTGAAAT (ID_REF), GDS878, AK020086

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7667974

GEO DataSets Gene

Select item 6447628314.

6030492E11Rik - Hypertension model: kidney

Annotation:: 6030492E11Rik, RIKEN cDNA 6030492E11 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100089107_TGI_at (ID_REF), GDS3675, AK020086

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64476283

GEO DataSets Gene Profile neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 77726) (14)
GEO Profiles
Homologene neighbors for GEO Profiles (Select 91149595) (0)
GEO Profiles
Profile neighbors for GEO Profiles (Select 77901339) (200)
GEO Profiles
Profile neighbors for GEO Profiles (Select 70976081) (200)
GEO Profiles
Chromosome neighbors for GEO Profiles (Select 77901342) (20)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 14

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity