GEO Profile Links for Gene (Select 77447) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 14

Select item 215891561.

9430096G21Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 9430096G21Rik, RIKEN cDNA 9430096G21 gene

Organism:: Mus musculus

Reporter:: GPL1942, 39156 (ID_REF), GDS1882, AK020526

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21589156

GEO DataSets Gene Profile neighbors

Select item 215891572.

9430096G21Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 9430096G21Rik, RIKEN cDNA 9430096G21 gene

Organism:: Mus musculus

Reporter:: GPL1942, 39157 (ID_REF), GDS1882, AK020526

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21589157

GEO DataSets Gene Profile neighbors

Select item 499575883.

9430096G21Rik - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: 9430096G21Rik, RIKEN cDNA 9430096G21 gene

Organism:: Mus musculus

Reporter:: GPL1536, 1220464_1 (ID_REF), GDS3148, AK020526

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49957588

GEO DataSets Gene Profile neighbors

Select item 619608074.

9430096G21Rik - Eset depletion effect on embryonic stem cell

Annotation:: 9430096G21Rik, RIKEN cDNA 9430096G21 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl3979.1.1_138-S (ID_REF), GDS3599, 9430096G21Rik (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61960807

GEO DataSets Gene Profile neighbors

Select item 716762415.

9430096G21Rik - Fasting effect on multiple tissues: time course

Annotation:: 9430096G21Rik, RIKEN cDNA 9430096G21 gene

Organism:: Mus musculus

Reporter:: GPL11012, 10741 (ID_REF), GDS3893, AK020526

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71676241

GEO DataSets Gene

Select item 978539906.

9430096G21Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: 9430096G21Rik, RIKEN cDNA 9430096G21 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100084453_TGI_at (ID_REF), GDS4527, AK020526

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97853990

GEO DataSets Gene Profile neighbors

Select item 643417907.

9430096G21Rik - Hypertension model: aorta

Annotation:: 9430096G21Rik, RIKEN cDNA 9430096G21 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100084453_TGI_at (ID_REF), GDS3672, AK020526

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64341790

GEO DataSets Gene Profile neighbors

Select item 625612078.

9430096G21Rik - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: 9430096G21Rik, RIKEN cDNA 9430096G21 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl3979.1.1_138-S (ID_REF), GDS3621, 9430096G21Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62561207

GEO DataSets Gene Profile neighbors

Select item 644209909.

9430096G21Rik - Hypertension model: liver

Annotation:: 9430096G21Rik, RIKEN cDNA 9430096G21 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100084453_TGI_at (ID_REF), GDS3674, AK020526

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64420990

GEO DataSets Gene Profile neighbors

Select item 762946410.

9430096G21Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: 9430096G21Rik, RIKEN cDNA 9430096G21 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGACTGGGTCTGGAGG (ID_REF), GDS878, AK020526

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7629464

GEO DataSets Gene

Select item 749176411.

9430096G21Rik - MPSS transcriptome analysis project

Annotation:: 9430096G21Rik, RIKEN cDNA 9430096G21 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGACTGGGTCTGGAGG (ID_REF), GDS868, AK020526

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7491764

GEO DataSets Gene

Select item 6438139012.

9430096G21Rik - Hypertension model: heart

Annotation:: 9430096G21Rik, RIKEN cDNA 9430096G21 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100084453_TGI_at (ID_REF), GDS3673, AK020526

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64381390

GEO DataSets Gene Profile neighbors

Select item 9714099013.

9430096G21Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: 9430096G21Rik, RIKEN cDNA 9430096G21 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100084453_TGI_at (ID_REF), GDS4495, AK020526

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97140990

GEO DataSets Gene Profile neighbors

Select item 6446059014.

9430096G21Rik - Hypertension model: kidney

Annotation:: 9430096G21Rik, RIKEN cDNA 9430096G21 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100084453_TGI_at (ID_REF), GDS3675, AK020526

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64460590

GEO DataSets Gene Profile neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 77447) (14)
GEO Profiles
Mus musculus RIKEN cDNA 2900057C04 gene (2900057C04Rik), mRNA
Mus musculus RIKEN cDNA 2900057C04 gene (2900057C04Rik), mRNA
gi|22122780|ref|NM_146221.1|

Nucleotide

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 14

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity