GEO Profile Links for Gene (Select 75022) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 16

Select item 499538841.

4930471L23Rik - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: 4930471L23Rik, RIKEN cDNA 4930471L23 gene

Organism:: Mus musculus

Reporter:: GPL1536, 1226793_1 (ID_REF), GDS3148, AK015553

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49953884

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 215851832.

4930471L23Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 4930471L23Rik, RIKEN cDNA 4930471L23 gene

Organism:: Mus musculus

Reporter:: GPL1942, 35183 (ID_REF), GDS1882, AK015553

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21585183

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 215851843.

4930471L23Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 4930471L23Rik, RIKEN cDNA 4930471L23 gene

Organism:: Mus musculus

Reporter:: GPL1942, 35184 (ID_REF), GDS1882, AK015553

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21585184

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 644008764.

4930471L23Rik - Hypertension model: heart

Annotation:: 4930471L23Rik, RIKEN cDNA 4930471L23 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100080696_TGI_at (ID_REF), GDS3673, AK015553

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64400876

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 619569205.

4930471L23Rik - Eset depletion effect on embryonic stem cell

Annotation:: 4930471L23Rik, RIKEN cDNA 4930471L23 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl50517.1.29_95-S (ID_REF), GDS3599, 4930471L23Rik (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61956920

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1278322546.

4930471L23Rik - Rhabdomyosarcoma model

Annotation:: 4930471L23Rik, RIKEN cDNA 4930471L23 gene

Organism:: Mus musculus

Reporter:: GPL6481, 105700609 (ID_REF), GDS5527, 4930471L23Rik (CLONE ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 127832254

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 644800767.

4930471L23Rik - Hypertension model: kidney

Annotation:: 4930471L23Rik, RIKEN cDNA 4930471L23 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100080696_TGI_at (ID_REF), GDS3675, AK015553

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64480076

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 716862238.

4930471L23Rik - Fasting effect on multiple tissues: time course

Annotation:: 4930471L23Rik, RIKEN cDNA 4930471L23 gene

Organism:: Mus musculus

Reporter:: GPL11012, 20723 (ID_REF), GDS3893, AK015553

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71686223

GEO DataSets Gene Chromosome neighbors

Select item 625573209.

4930471L23Rik - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: 4930471L23Rik, RIKEN cDNA 4930471L23 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl50517.1.29_95-S (ID_REF), GDS3621, 4930471L23Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62557320

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 7565955410.

4930471L23Rik - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: 4930471L23Rik, RIKEN cDNA 4930471L23 gene

Organism:: Mus musculus

Reporter:: GPL6481, 105700609 (ID_REF), GDS4002, 4930471L23Rik (CLONE ID)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75659554

GEO DataSets Gene Chromosome neighbors

Select item 6444047611.

4930471L23Rik - Hypertension model: liver

Annotation:: 4930471L23Rik, RIKEN cDNA 4930471L23 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100080696_TGI_at (ID_REF), GDS3674, AK015553

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64440476

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 9787347612.

4930471L23Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: 4930471L23Rik, RIKEN cDNA 4930471L23 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100080696_TGI_at (ID_REF), GDS4527, AK015553

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97873476

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 763428113.

4930471L23Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: 4930471L23Rik, RIKEN cDNA 4930471L23 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCAAGAGGTAACTCCAGG (ID_REF), GDS878, CN836774

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7634281

GEO DataSets Gene Chromosome neighbors

Select item 6436127614.

4930471L23Rik - Hypertension model: aorta

Annotation:: 4930471L23Rik, RIKEN cDNA 4930471L23 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100080696_TGI_at (ID_REF), GDS3672, AK015553

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64361276

GEO DataSets Gene Chromosome neighbors

Select item 9716047615.

4930471L23Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: 4930471L23Rik, RIKEN cDNA 4930471L23 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100080696_TGI_at (ID_REF), GDS4495, AK015553

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97160476

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 749658116.

4930471L23Rik - MPSS transcriptome analysis project

Annotation:: 4930471L23Rik, RIKEN cDNA 4930471L23 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCAAGAGGTAACTCCAGG (ID_REF), GDS868, CN836774

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7496581

GEO DataSets Gene Chromosome neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 75022) (16)
GEO Profiles
unnamed protein product [Mus musculus]
unnamed protein product [Mus musculus]
gi|12834755|dbj|BAB23031.1|

Protein

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 16

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity