GEO Profile Links for Gene (Select 74893) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 14

Select item 215955321.

4930453C13Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 4930453C13Rik, RIKEN cDNA 4930453C13 gene

Organism:: Mus musculus

Reporter:: GPL1942, 45532 (ID_REF), GDS1882, AK015450

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21595532

GEO DataSets Gene Profile neighbors

Select item 716823962.

4930453C13Rik - Fasting effect on multiple tissues: time course

Annotation:: 4930453C13Rik, RIKEN cDNA 4930453C13 gene

Organism:: Mus musculus

Reporter:: GPL11012, 16896 (ID_REF), GDS3893, AK015450

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71682396

GEO DataSets Gene Profile neighbors

Select item 978665573.

4930453C13Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: 4930453C13Rik, RIKEN cDNA 4930453C13 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100093090_TGI_at (ID_REF), GDS4527, AK015450

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97866557

GEO DataSets Gene Profile neighbors

Select item 971535574.

4930453C13Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: 4930453C13Rik, RIKEN cDNA 4930453C13 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100093090_TGI_at (ID_REF), GDS4495, AK015450

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97153557

GEO DataSets Gene Profile neighbors

Select item 499581275.

4930453C13Rik - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: 4930453C13Rik, RIKEN cDNA 4930453C13 gene

Organism:: Mus musculus

Reporter:: GPL1536, 1225687_1 (ID_REF), GDS3148, AK015450

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49958127

GEO DataSets Gene

Select item 643543576.

4930453C13Rik - Hypertension model: aorta

Annotation:: 4930453C13Rik, RIKEN cDNA 4930453C13 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100093090_TGI_at (ID_REF), GDS3672, AK015450

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64354357

GEO DataSets Gene

Select item 215955317.

4930453C13Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 4930453C13Rik, RIKEN cDNA 4930453C13 gene

Organism:: Mus musculus

Reporter:: GPL1942, 45531 (ID_REF), GDS1882, AK015450

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21595531

GEO DataSets Gene Profile neighbors

Select item 625572388.

4930453C13Rik - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: 4930453C13Rik, RIKEN cDNA 4930453C13 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl12256.2.1_101-S (ID_REF), GDS3621, 4930453C13Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62557238

GEO DataSets Gene Profile neighbors

Select item 75071519.

4930453C13Rik - MPSS transcriptome analysis project

Annotation:: 4930453C13Rik, RIKEN cDNA 4930453C13 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCCAGAGATGCAAGCATA (ID_REF), GDS868, AK015450

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7507151

GEO DataSets Gene

Select item 6439395710.

4930453C13Rik - Hypertension model: heart

Annotation:: 4930453C13Rik, RIKEN cDNA 4930453C13 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100093090_TGI_at (ID_REF), GDS3673, AK015450

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64393957

GEO DataSets Gene Profile neighbors

Select item 764485111.

4930453C13Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: 4930453C13Rik, RIKEN cDNA 4930453C13 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCCAGAGATGCAAGCATA (ID_REF), GDS878, AK015450

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7644851

GEO DataSets Gene

Select item 6443355712.

4930453C13Rik - Hypertension model: liver

Annotation:: 4930453C13Rik, RIKEN cDNA 4930453C13 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100093090_TGI_at (ID_REF), GDS3674, AK015450

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64433557

GEO DataSets Gene Profile neighbors

Select item 6447315713.

4930453C13Rik - Hypertension model: kidney

Annotation:: 4930453C13Rik, RIKEN cDNA 4930453C13 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100093090_TGI_at (ID_REF), GDS3675, AK015450

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64473157

GEO DataSets Gene Profile neighbors

Select item 6195683814.

4930453C13Rik - Eset depletion effect on embryonic stem cell

Annotation:: 4930453C13Rik, RIKEN cDNA 4930453C13 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl12256.2.1_101-S (ID_REF), GDS3599, 4930453C13Rik (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61956838

GEO DataSets Gene Profile neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 74893) (14)
GEO Profiles
Interleukin 17A effect on monocyte-derived dendritic cells
Interleukin 17A effect on monocyte-derived dendritic cells
Accession: GDS5817

GEO DataSets
Related DataSets for GEO Profiles (Select 131576815) (1)
GEO DataSets
dual serine/threonine and tyrosine protein kinase [Rattus norvegicus]
dual serine/threonine and tyrosine protein kinase [Rattus norvegicus]
gi|40807349|ref|NP_955750.1|

Protein
ankyrin repeat and IBR domain-containing protein 1 [Homo sapiens]
ankyrin repeat and IBR domain-containing protein 1 [Homo sapiens]
gi|148596953|ref|NP_061877.1|

Protein

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 14

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity