GEO Profile Links for Gene (Select 73892) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 16

Select item 499526481.

4930423D24Rik - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: 4930423D24Rik, RIKEN cDNA 4930423D24 gene

Organism:: Mus musculus

Reporter:: GPL1536, 1221553_1 (ID_REF), GDS3148, AK015188

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49952648

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 625570012.

4930423D24Rik - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: 4930423D24Rik, RIKEN cDNA 4930423D24 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl38402.4.1_149-S (ID_REF), GDS3621, 4930423D24Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62557001

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 716707133.

4930423D24Rik - Fasting effect on multiple tissues: time course

Annotation:: 4930423D24Rik, RIKEN cDNA 4930423D24 gene

Organism:: Mus musculus

Reporter:: GPL11012, 5213 (ID_REF), GDS3893, AK015188

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71670713

GEO DataSets Gene Chromosome neighbors

Select item 756882984.

4930423D24Rik - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: 4930423D24Rik, RIKEN cDNA 4930423D24 gene

Organism:: Mus musculus

Reporter:: GPL6481, 100050600 (ID_REF), GDS4002, 4930423D24Rik (CLONE ID)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75688298

GEO DataSets Gene Chromosome neighbors

Select item 619566015.

4930423D24Rik - Eset depletion effect on embryonic stem cell

Annotation:: 4930423D24Rik, RIKEN cDNA 4930423D24 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl38402.4.1_149-S (ID_REF), GDS3599, 4930423D24Rik (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61956601

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 644521786.

4930423D24Rik - Hypertension model: kidney

Annotation:: 4930423D24Rik, RIKEN cDNA 4930423D24 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100101335_TGI_at (ID_REF), GDS3675, AK015188

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64452178

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 215874557.

4930423D24Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 4930423D24Rik, RIKEN cDNA 4930423D24 gene

Organism:: Mus musculus

Reporter:: GPL1942, 37455 (ID_REF), GDS1882, AK015188

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21587455

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 644125788.

4930423D24Rik - Hypertension model: liver

Annotation:: 4930423D24Rik, RIKEN cDNA 4930423D24 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100101335_TGI_at (ID_REF), GDS3674, AK015188

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64412578

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 74898109.

4930423D24Rik - MPSS transcriptome analysis project

Annotation:: 4930423D24Rik, RIKEN cDNA 4930423D24 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTCTCACAGAGTTGGC (ID_REF), GDS868, AK015188

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7489810

GEO DataSets Gene Chromosome neighbors

Select item 6433337810.

4930423D24Rik - Hypertension model: aorta

Annotation:: 4930423D24Rik, RIKEN cDNA 4930423D24 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100101335_TGI_at (ID_REF), GDS3672, AK015188

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64333378

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 6437297811.

4930423D24Rik - Hypertension model: heart

Annotation:: 4930423D24Rik, RIKEN cDNA 4930423D24 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100101335_TGI_at (ID_REF), GDS3673, AK015188

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64372978

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 2158745612.

4930423D24Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 4930423D24Rik, RIKEN cDNA 4930423D24 gene

Organism:: Mus musculus

Reporter:: GPL1942, 37456 (ID_REF), GDS1882, AK015188

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21587456

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 9713257813.

4930423D24Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: 4930423D24Rik, RIKEN cDNA 4930423D24 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100101335_TGI_at (ID_REF), GDS4495, AK015188

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97132578

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12786099814.

4930423D24Rik - Rhabdomyosarcoma model

Annotation:: 4930423D24Rik, RIKEN cDNA 4930423D24 gene

Organism:: Mus musculus

Reporter:: GPL6481, 100050600 (ID_REF), GDS5527, 4930423D24Rik (CLONE ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 127860998

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 9784557815.

4930423D24Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: 4930423D24Rik, RIKEN cDNA 4930423D24 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100101335_TGI_at (ID_REF), GDS4527, AK015188

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97845578

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 762751016.

4930423D24Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: 4930423D24Rik, RIKEN cDNA 4930423D24 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTCTCACAGAGTTGGC (ID_REF), GDS878, AK015188

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7627510

GEO DataSets Gene Chromosome neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 73892) (16)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 16

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity