GEO Profile Links for Gene (Select 71565) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 14

Select item 499533731.

9030418E23Rik - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: 9030418E23Rik, RIKEN cDNA 9030418E23 gene

Organism:: Mus musculus

Reporter:: GPL1536, 1221089_1 (ID_REF), GDS3148, AK018517

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49953373

GEO DataSets Gene Profile neighbors

Select item 716782402.

9030418E23Rik - Fasting effect on multiple tissues: time course

Annotation:: 9030418E23Rik, RIKEN cDNA 9030418E23 gene

Organism:: Mus musculus

Reporter:: GPL11012, 12740 (ID_REF), GDS3893, AK018517

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71678240

GEO DataSets Gene Profile neighbors

Select item 971415093.

9030418E23Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: 9030418E23Rik, RIKEN cDNA 9030418E23 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100080858_TGI_at (ID_REF), GDS4495, AK018517

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97141509

GEO DataSets Gene Profile neighbors

Select item 75070734.

9030418E23Rik - MPSS transcriptome analysis project

Annotation:: 9030418E23Rik, RIKEN cDNA 9030418E23 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCAAGCACACCTGGAACT (ID_REF), GDS868, AK018517

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7507073

GEO DataSets Gene

Select item 625605375.

9030418E23Rik - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: 9030418E23Rik, RIKEN cDNA 9030418E23 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl19328.1.1_299-S (ID_REF), GDS3621, 9030418E23Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62560537

GEO DataSets Gene Profile neighbors

Select item 215847576.

9030418E23Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 9030418E23Rik, RIKEN cDNA 9030418E23 gene

Organism:: Mus musculus

Reporter:: GPL1942, 34757 (ID_REF), GDS1882, AK018517

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21584757

GEO DataSets Gene Profile neighbors

Select item 643819097.

9030418E23Rik - Hypertension model: heart

Annotation:: 9030418E23Rik, RIKEN cDNA 9030418E23 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100080858_TGI_at (ID_REF), GDS3673, AK018517

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64381909

GEO DataSets Gene Profile neighbors

Select item 215847568.

9030418E23Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 9030418E23Rik, RIKEN cDNA 9030418E23 gene

Organism:: Mus musculus

Reporter:: GPL1942, 34756 (ID_REF), GDS1882, AK018517

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21584756

GEO DataSets Gene Profile neighbors

Select item 978545099.

9030418E23Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: 9030418E23Rik, RIKEN cDNA 9030418E23 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100080858_TGI_at (ID_REF), GDS4527, AK018517

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97854509

GEO DataSets Gene Profile neighbors

Select item 6446110910.

9030418E23Rik - Hypertension model: kidney

Annotation:: 9030418E23Rik, RIKEN cDNA 9030418E23 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100080858_TGI_at (ID_REF), GDS3675, AK018517

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64461109

GEO DataSets Gene Profile neighbors

Select item 6442150911.

9030418E23Rik - Hypertension model: liver

Annotation:: 9030418E23Rik, RIKEN cDNA 9030418E23 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100080858_TGI_at (ID_REF), GDS3674, AK018517

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64421509

GEO DataSets Gene Profile neighbors

Select item 764477312.

9030418E23Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: 9030418E23Rik, RIKEN cDNA 9030418E23 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCAAGCACACCTGGAACT (ID_REF), GDS878, AK018517

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7644773

GEO DataSets Gene

Select item 6434230913.

9030418E23Rik - Hypertension model: aorta

Annotation:: 9030418E23Rik, RIKEN cDNA 9030418E23 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100080858_TGI_at (ID_REF), GDS3672, AK018517

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64342309

GEO DataSets Gene

Select item 6196013714.

9030418E23Rik - Eset depletion effect on embryonic stem cell

Annotation:: 9030418E23Rik, RIKEN cDNA 9030418E23 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl19328.1.1_299-S (ID_REF), GDS3599, 9030418E23Rik (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61960137

GEO DataSets Gene Profile neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 71565) (14)
GEO Profiles
Taxonomy Links for PopSet (Select 241960425) (28)
Taxonomy
Protein Links for PopSet (Select 289188416) (613)
Protein
txid442392[Organism:exp] (3)
BioProject
Tssr96219 AND (alive[prop]) (0)
Gene

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 14

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity