GEO Profile Links for Gene (Select 67074) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 2463

<< First< Prev

Page of 124

Next >Last >>

Select item 290889231.

Mon2 - Mammary epithelial stem cells (MG-430B)

Annotation:: Mon2, MON2 homolog, regulator of endosome to Golgi trafficking

Organism:: Mus musculus

Reporter:: GPL340, 1428817_at (ID_REF), GDS2254, 67074 (Gene ID), BB663418

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 29088923

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 273898282.

Annotation:: Mon2, MON2 homolog, regulator of endosome to Golgi trafficking

Organism:: Mus musculus

Reporter:: GPL82, 112846_at (ID_REF), GDS2185, 67074 (Gene ID), AI835019

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 27389828

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 969595213.

Mon2 - Lmna G609G knock-in model of Hutchinson-Gilford Progeria Syndrome: liver

Annotation:: Mon2, MON2 homolog, regulator of endosome to Golgi trafficking

Organism:: Mus musculus

Reporter:: GPL6246, 10372928 (ID_REF), GDS4490, NM_001163024, NM_001163025, NM_153395, AB014059, BC064131, BC150943, AK163740, chr10:122995163-123076505 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 96959521

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 375360234.

Mon2 - Embryonic J1 stem cell differentiation in vitro (MG-430B)

Annotation:: Mon2, MON2 homolog, regulator of endosome to Golgi trafficking

Organism:: Mus musculus

Reporter:: GPL340, 1428817_at (ID_REF), GDS2669, 67074 (Gene ID), BB663418

DataSet type:: Expression profiling by array, count, 33 samples

ID:: 37536023

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 166362235.

Mon2 - Inbred Long Sleep and Inbred Short Sleep model of ethanol sensitivity: cerebellum (MG-430B)

Annotation:: Mon2, MON2 homolog, regulator of endosome to Golgi trafficking

Organism:: Mus musculus

Reporter:: GPL340, 1428817_at (ID_REF), GDS1610, 67074 (Gene ID), BB663418

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 16636223

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 101892236.

Mon2 - Blastocyst response to various MAPK pathway inhibitors (MOE430B)

Annotation:: Mon2, MON2 homolog, regulator of endosome to Golgi trafficking

Organism:: Mus musculus

Reporter:: GPL340, 1428817_at (ID_REF), GDS1108, 67074 (Gene ID), BB663418

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 10189223

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12527287.

Mon2 - Hyperoxic lung injury (U74Bv2)

Annotation:: Mon2, MON2 homolog, regulator of endosome to Golgi trafficking

Organism:: Mus musculus

Reporter:: GPL82, 112846_at (ID_REF), GDS248, 67074 (Gene ID), AI835019

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 1252728

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 573391568.

Mon2 - Kras G12D heterozygous mutation effect on somatic cell line (Sentrix MouseRef-8)

Annotation:: Mon2, MON2 homolog, regulator of endosome to Golgi trafficking

Organism:: Mus musculus

Reporter:: GPL4865, scl0067074.2_293-S (ID_REF), GDS3456, NM_153395

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 57339156

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 536294239.

Mon2 - Calcium-signaling effects on blastocyts

Annotation:: Mon2, MON2 homolog, regulator of endosome to Golgi trafficking

Organism:: Mus musculus

Reporter:: GPL1261, 1428817_at (ID_REF), GDS3293, 67074 (Gene ID), BB663418

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 53629423

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2652672310.

Mon2 - RNA helicase p68/p72 knockdown effect on skeletal muscle cells (MG-430B)

Annotation:: Mon2, MON2 homolog, regulator of endosome to Golgi trafficking

Organism:: Mus musculus

Reporter:: GPL340, 1428817_at (ID_REF), GDS2152, 67074 (Gene ID), BB663418

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 26526723

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 850452311.

Mon2 - Asthma and interleukin 13 (MOE430B)

Annotation:: Mon2, MON2 homolog, regulator of endosome to Golgi trafficking

Organism:: Mus musculus

Reporter:: GPL340, 1428817_at (ID_REF), GDS959, 67074 (Gene ID), BB663418

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 8504523

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 761903212.

Mon2 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Mon2, MON2 homolog, regulator of endosome to Golgi trafficking

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTCCCGTATGCCAACC (ID_REF), GDS878, BC048406

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7619032

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 699152813.

Mon2 - Spermatogonia in Zfp145 knockout (MG-U74B)

Annotation:: Mon2, MON2 homolog, regulator of endosome to Golgi trafficking

Organism:: Mus musculus

Reporter:: GPL82, 112846_at (ID_REF), GDS836, 67074 (Gene ID), AI835019

DataSet type:: Expression profiling by array, count, 2 samples

ID:: 6991528

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 415822814.

Mon2 - Mesangioblast stem cell clone comparison (MG-U74B)

Annotation:: Mon2, MON2 homolog, regulator of endosome to Golgi trafficking

Organism:: Mus musculus

Reporter:: GPL82, 112846_at (ID_REF), GDS554, 67074 (Gene ID), AI835019

DataSet type:: Expression profiling by array, count, 2 samples

ID:: 4158228

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2339592315.

Mon2 - Lymphotoxin-beta receptor signaling inhibition effect on lymph nodes: time course (MG-430B)

Annotation:: Mon2, MON2 homolog, regulator of endosome to Golgi trafficking

Organism:: Mus musculus

Reporter:: GPL340, 1428817_at (ID_REF), GDS2005, 67074 (Gene ID), BB663418

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 23395923

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12624169216.

Mon2 - Metformin effect on Mycobacterium tuberculosis-infected lung

Annotation:: Mon2, MON2 homolog, regulator of endosome to Golgi trafficking

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2710773 (ID_REF), GDS5436, NM_153395, 2610528O22RIK (ORF)

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 126241692

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7462449217.

Mon2 - Bone marrow mesenchymal stem cells and renal and cardiac MSC-like cells

Annotation:: Mon2, MON2 homolog, regulator of endosome to Golgi trafficking

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2710773 (ID_REF), GDS3974, NM_153395, 2610528O22RIK (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 74624492

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5966777518.

Mon2 - Lung response to aerosolized non-typeable Haemophilus influenza lysate: time course

Annotation:: Mon2, MON2 homolog, regulator of endosome to Golgi trafficking

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2710774 (ID_REF), GDS3522, NM_153395

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 59667775

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2394762319.

Mon2 - Hoxa11/Hoxd11 null mutation effect on embryonic kidney development (MG-430B)

Annotation:: Mon2, MON2 homolog, regulator of endosome to Golgi trafficking

Organism:: Mus musculus

Reporter:: GPL340, 1428817_at (ID_REF), GDS2031, 67074 (Gene ID), BB663418

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 23947623

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1940682320.

Mon2 - Extraocular and hindlimb skeletal muscle cell differentiation: time course (MG-430B)

Annotation:: Mon2, MON2 homolog, regulator of endosome to Golgi trafficking

Organism:: Mus musculus

Reporter:: GPL340, 1428817_at (ID_REF), GDS1766, 67074 (Gene ID), BB663418

DataSet type:: Expression profiling by array, count, 30 samples

ID:: 19406823

GEO DataSets Gene Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 124

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 67074) (2463)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 2463

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity