GEO Profile Links for Gene (Select 65971) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 616251961.

Tbata - PTEN heterozygosity effect on Smoothened-active mouse model

Annotation:: Tbata, thymus, brain and testes associated

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2651010 (ID_REF), GDS3582, NM_001017407, 1700021K02RIK (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 61625196

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 114548522.

Tbata - 17beta-estradiol and genistein effect on thymus: time course

Annotation:: Tbata, thymus, brain and testes associated

Organism:: Mus musculus

Reporter:: GPL339, 1425957_x_at (ID_REF), GDS1275, 65971 (Gene ID), AF257503

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 11454852

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75330413.

Tbata - MPSS transcriptome analysis project

Annotation:: Tbata, thymus, brain and testes associated

Organism:: Mus musculus

Reporter:: GPL1010, GATCCACAGTCCAATCGGAA (ID_REF), GDS868, NM_023064

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7533041

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1122339764.

Tbata - Cystatin B knockout model of progressive myoclonus epilepsy: postnatal day 7 cerebellum

Annotation:: Tbata, thymus, brain and testes associated

Organism:: Mus musculus

Reporter:: GPL1261, 1450281_a_at (ID_REF), GDS5089, 65971 (Gene ID), NM_023064

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 112233976

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1129994635.

Tbata - T-cell factor 1-deficient thymic lymphoma

Annotation:: Tbata, thymus, brain and testes associated

Organism:: Mus musculus

Reporter:: GPL1261, 1425957_x_at (ID_REF), GDS4867, 65971 (Gene ID), AF257503

DataSet type:: Expression profiling by array, transformed count, 17 samples

ID:: 112999463

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 388214626.

Tbata - Pubertal mammary gland development

Annotation:: Tbata, thymus, brain and testes associated

Organism:: Mus musculus

Reporter:: GPL339, 1429956_at (ID_REF), GDS2721, 65971 (Gene ID)

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 38821462

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 585590767.

Tbata - Aire ectopic expression effect on pancreatic islet beta cells

Annotation:: Tbata, thymus, brain and testes associated

Organism:: Mus musculus

Reporter:: GPL1261, 1450281_a_at (ID_REF), GDS3491, 65971 (Gene ID), NM_023064

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 58559076

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1130237768.

Tbata - T-cell factor 1-deficient thymic lymphoma

Annotation:: Tbata, thymus, brain and testes associated

Organism:: Mus musculus

Reporter:: GPL1261, 1450281_a_at (ID_REF), GDS4867, 65971 (Gene ID), NM_023064

DataSet type:: Expression profiling by array, transformed count, 17 samples

ID:: 113023776

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 585347639.

Tbata - Aire ectopic expression effect on pancreatic islet beta cells

Annotation:: Tbata, thymus, brain and testes associated

Organism:: Mus musculus

Reporter:: GPL1261, 1425957_x_at (ID_REF), GDS3491, 65971 (Gene ID), AF257503

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 58534763

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1146304410.

Tbata - 17beta-estradiol and genistein effect on thymus: time course

Annotation:: Tbata, thymus, brain and testes associated

Organism:: Mus musculus

Reporter:: GPL339, 1450281_a_at (ID_REF), GDS1275, 65971 (Gene ID), NM_023064

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 11463044

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1145602511.

Tbata - 17beta-estradiol and genistein effect on thymus: time course

Annotation:: Tbata, thymus, brain and testes associated

Organism:: Mus musculus

Reporter:: GPL339, 1427130_x_at (ID_REF), GDS1275, 65971 (Gene ID), AJ249392

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 11456025

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6838327612.

Tbata - Lung response to chronic and acute exposure to ingested arsenic

Annotation:: Tbata, thymus, brain and testes associated

Organism:: Mus musculus

Reporter:: GPL1261, 1450281_a_at (ID_REF), GDS3801, 65971 (Gene ID), NM_023064

DataSet type:: Expression profiling by array, transformed count, 55 samples

ID:: 68383276

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11300063613.

Tbata - T-cell factor 1-deficient thymic lymphoma

Annotation:: Tbata, thymus, brain and testes associated

Organism:: Mus musculus

Reporter:: GPL1261, 1427130_x_at (ID_REF), GDS4867, 65971 (Gene ID), AJ249392

DataSet type:: Expression profiling by array, transformed count, 17 samples

ID:: 113000636

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3276614.

Tbata - Type 1 diabetes gene expression profiling

Annotation:: Tbata, Thymus, brain and testes associated

Organism:: Mus musculus

Reporter:: GPL24, 5766 (ID_REF), GDS10, AA110638

DataSet type:: Expression profiling by array, count, 28 samples

ID:: 32766

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7062967615.

Tbata - Embryonic development of male reproductive tract tissues

Annotation:: Tbata, thymus, brain and testes associated

Organism:: Mus musculus

Reporter:: GPL1261, 1450281_a_at (ID_REF), GDS3862, 65971 (Gene ID), NM_023064

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 70629676

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6835896316.

Tbata - Lung response to chronic and acute exposure to ingested arsenic

Annotation:: Tbata, thymus, brain and testes associated

Organism:: Mus musculus

Reporter:: GPL1261, 1425957_x_at (ID_REF), GDS3801, 65971 (Gene ID), AF257503

DataSet type:: Expression profiling by array, transformed count, 55 samples

ID:: 68358963

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9384886217.

Tbata - MYC-driven medulloblastoma model

Annotation:: Tbata, thymus, brain and testes associated

Organism:: Mus musculus

Reporter:: GPL1261, 1429956_at (ID_REF), GDS4478, 65971 (Gene ID)

DataSet type:: Expression profiling by array, transformed count, 19 samples

ID:: 93848862

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6158819518.

Tbata - PTEN heterozygosity effect on Smoothened-active mouse model

Annotation:: Tbata, thymus, brain and testes associated

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3131640 (ID_REF), GDS3582, NM_001017441, 1700021K02RIK (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 61588195

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4986543619.

Tbata - Various tissues

Annotation:: Tbata, thymus, brain and testes associated

Organism:: Mus musculus

Reporter:: GPL1261, 1427130_x_at (ID_REF), GDS3142, 65971 (Gene ID), AJ249392

DataSet type:: Expression profiling by array, count, 70 samples

ID:: 49865436

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4986426320.

Tbata - Various tissues

Annotation:: Tbata, thymus, brain and testes associated

Organism:: Mus musculus

Reporter:: GPL1261, 1425957_x_at (ID_REF), GDS3142, 65971 (Gene ID), AF257503

DataSet type:: Expression profiling by array, count, 70 samples

ID:: 49864263

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 65971) (1000)
GEO Profiles
Mus musculus solute carrier family 30 (zinc transporter), member 6 (Slc30a6), mR...
Mus musculus solute carrier family 30 (zinc transporter), member 6 (Slc30a6), mRNA
gi|146149177|ref|NM_144798.4|

Nucleotide
Mus musculus helicase-like transcription factor (Hltf), transcript variant 4, no...
Mus musculus helicase-like transcription factor (Hltf), transcript variant 4, non-coding RNA
gi|562815410|ref|NR_105047.1|

Nucleotide
Taxonomy Links for Nucleotide (Select 2462546875) (1)
Taxonomy
cytochrome b, partial (mitochondrion) [Urocitellus undulatus undulatus]
cytochrome b, partial (mitochondrion) [Urocitellus undulatus undulatus]
gi|1355730466|gb|AVK92488.1|

Protein

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity