GEO Profile Links for Gene (Select 545276) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 330

<< First< Prev

Page of 17

Next >Last >>

Select item 75081771.

Gal3st3 - MPSS transcriptome analysis project

Annotation:: Gal3st3, galactose-3-O-sulfotransferase 3

Organism:: Mus musculus

Reporter:: GPL1010, GATCCGCCTGCCTCCAGGAA (ID_REF), GDS868, BC066996

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7508177

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 974299232.

Gal3st3 - Model for the manic pole of bipolar disorder: hippocampus

Annotation:: Gal3st3, galactose-3-O-sulfotransferase 3

Organism:: Mus musculus

Reporter:: GPL6246, 10460556 (ID_REF), GDS4517, NM_001024717, BC066996, chr19:5298341-5308739 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 97429923

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 731378233.

Gal3st3 - Adrenergic stress effect on transcription factor GATA4 S105A mutants: heart ventricle

Annotation:: Gal3st3, galactose-3-O-sulfotransferase 3

Organism:: Mus musculus

Reporter:: GPL6246, 10460556 (ID_REF), GDS3931, NM_001024717, BC066996, chr19:5298341-5308739 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 73137823

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 731649404.

Gal3st3 - Embryonic fibroblast response to forced expression of select transcription factors

Annotation:: Gal3st3, galactose-3-O-sulfotransferase 3

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3033192 (ID_REF), GDS3932, NM_001024717

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 73164940

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1064314235.

Gal3st3 - Histone deacetylase 3 deficiency effect on the heart

Annotation:: Gal3st3, galactose-3-O-sulfotransferase 3

Organism:: Mus musculus

Reporter:: GPL6246, 10460556 (ID_REF), GDS4886, NM_001024717, BC066996, chr19:5298341-5308739 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 106431423

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 968315236.

Gal3st3 - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Gal3st3, galactose-3-O-sulfotransferase 3

Organism:: Mus musculus

Reporter:: GPL6246, 10460556 (ID_REF), GDS4486, NM_001024717, BC066996, chr19:5298341-5308739 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96831523

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1065940237.

Gal3st3 - Heart response to isocitrate dehydrogenase 2 mutations IDH2R140Q and IDH2R172K

Annotation:: Gal3st3, galactose-3-O-sulfotransferase 3

Organism:: Mus musculus

Reporter:: GPL6246, 10460556 (ID_REF), GDS4893, NM_001024717, BC066996, chr19:5298341-5308739 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 106594023

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 921958238.

Gal3st3 - 16p11.2 copy number variation models: various brain regions

Annotation:: Gal3st3, galactose-3-O-sulfotransferase 3

Organism:: Mus musculus

Reporter:: GPL6246, 10460556 (ID_REF), GDS4430, NM_001024717, BC066996, chr19:5298341-5308739 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 37 samples

ID:: 92195823

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1167447519.

Gal3st3 - Wig-1 depletion effect on brain striatum of mutant huntingtin transgenic animal

Annotation:: Gal3st3, galactose-3-O-sulfotransferase 3

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3033192 (ID_REF), GDS5185, NM_001024717, GAL3ST3 (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 116744751

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8719042310.

Gal3st3 - Polycomb histone methyltransferase Ezh2-deficient hearts: right ventricle and interventricular septum

Annotation:: Gal3st3, galactose-3-O-sulfotransferase 3

Organism:: Mus musculus

Reporter:: GPL6246, 10460556 (ID_REF), GDS4309, NM_001024717, BC066996, chr19:5298341-5308739 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 87190423

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11863695111.

Gal3st3 - 20-hydroxyecdysone effect on skeletal muscle: time course

Annotation:: Gal3st3, galactose-3-O-sulfotransferase 3

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3033192 (ID_REF), GDS5237, NM_001024717, GAL3ST3 (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 118636951

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10955312312.

Gal3st3 - Neonatal stress and morphine effects on right hippocampus

Annotation:: Gal3st3, galactose-3-O-sulfotransferase 3

Organism:: Mus musculus

Reporter:: GPL6246, 10460556 (ID_REF), GDS5009, NM_001024717, BC066996, chr19:5298341-5308739 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 15 samples

ID:: 109553123

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11890032313.

Gal3st3 - Mmp-8 deficient ankle joint response to the induction of arthritis

Annotation:: Gal3st3, galactose-3-O-sulfotransferase 3

Organism:: Mus musculus

Reporter:: GPL6246, 10460556 (ID_REF), GDS5243, NM_001024717, BC066996, chr19:5298341-5308739 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 118900323

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12759224014.

Gal3st3 - Progranulin deficiency effect on various brain regions: time course

Annotation:: Gal3st3, galactose-3-O-sulfotransferase 3

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3033192 (ID_REF), GDS5501, NM_001024717

DataSet type:: Expression profiling by array, transformed count, 99 samples

ID:: 127592240

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7510062315.

Gal3st3 - Segmented filamentous bacteria gut colonization effect on nonobese diabetic mice: T cells

Annotation:: Gal3st3, galactose-3-O-sulfotransferase 3

Organism:: Mus musculus

Reporter:: GPL6246, 10460556 (ID_REF), GDS3987, NM_001024717, BC066996, chr19:5298341-5308739 (SPOT ID)

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 75100623

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10718262316.

Gal3st3 - Cyclophilin D deficiency effect on the heart

Annotation:: Gal3st3, galactose-3-O-sulfotransferase 3

Organism:: Mus musculus

Reporter:: GPL6246, 10460556 (ID_REF), GDS4913, NM_001024717, BC066996, chr19:5298341-5308739 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 107182623

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8727362317.

Gal3st3 - Sex effect on acute coxsackievirus B3-induced myocarditis: heart

Annotation:: Gal3st3, galactose-3-O-sulfotransferase 3

Organism:: Mus musculus

Reporter:: GPL6246, 10460556 (ID_REF), GDS4311, NM_001024717, BC066996, chr19:5298341-5308739 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 87273623

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11291805518.

Gal3st3 - P81S von Hippel-Lindau mutation effect on embryonic stem cell teratomas

Annotation:: Gal3st3, galactose-3-O-sulfotransferase 3

Organism:: Mus musculus

Reporter:: GPL11533, 10460556 (ID_REF), GDS4865, NM_001024717, BC066996, chr19:5298341-5308739 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 112918055

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9233542319.

Gal3st3 - MyD88 and TRIF deficient spleen response to septic peritonitis

Annotation:: Gal3st3, galactose-3-O-sulfotransferase 3

Organism:: Mus musculus

Reporter:: GPL6246, 10460556 (ID_REF), GDS4433, NM_001024717, BC066996, chr19:5298341-5308739 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 92335423

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8360632320.

Gal3st3 - Transcription factor MIST1-null and MIST1-induced pancreas

Annotation:: Gal3st3, galactose-3-O-sulfotransferase 3

Organism:: Mus musculus

Reporter:: GPL6246, 10460556 (ID_REF), GDS4341, NM_001024717, BC066996, chr19:5298341-5308739 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 83606323

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 17

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 545276) (330)
GEO Profiles
GEO Profile Links for Gene (Select 225058) (622)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 330

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity