GEO Profile Links for Gene (Select 435366) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 308

<< First< Prev

Page of 16

Next >Last >>

Select item 284784691.

Intra-abdominal adhesions effect on the small intestine: time course

Annotation:: CDNA clone IMAGE:5689029

Organism:: Mus musculus

Reporter:: GPL3695, 1569 (ID_REF), GDS2224, AI429292, 6720457D02Rik (ORF)

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 28478469

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 214416322.

Platr25 - Integrin beta-6 deficiency model of emphysema: alveolar macrophage

Annotation:: Platr25, pluripotency associated transcript 25

Organism:: Mus musculus

Reporter:: GPL1792, MmBG000038 (ID_REF), GDS1874, BC032201

DataSet type:: Expression profiling by array, log ratio, 15 samples

ID:: 21441632

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1316502833.

Platr25 - Normal liver developmental stages: embryonic and postnatal

Annotation:: Platr25, pluripotency associated transcript 25

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P372400 (ID_REF), GDS5818, BC032201, A_52_P372400 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 11 samples

ID:: 131650283

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1316465974.

Platr25 - Normal liver developmental stages: embryonic and postnatal

Annotation:: Platr25, pluripotency associated transcript 25

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P25259 (ID_REF), GDS5818, BC058422, A_52_P25259 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 11 samples

ID:: 131646597

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 971462885.

Platr25 - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: Platr25, pluripotency associated transcript 25

Organism:: Mus musculus

Reporter:: GPL9734, 100084454_TGI_at (ID_REF), GDS4495, BC058422

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97146288

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 643470886.

Platr25 - Hypertension model: aorta

Annotation:: Platr25, pluripotency associated transcript 25

Organism:: Mus musculus

Reporter:: GPL9734, 100084454_TGI_at (ID_REF), GDS3672, BC058422

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64347088

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 753727187.

Platr25 - Developing testis and ovary

Annotation:: Platr25, pluripotency associated transcript 25

Organism:: Mus musculus

Reporter:: GPL6246, 10409994 (ID_REF), GDS3995, BC032201, chr13:62699399-62706274 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 91 samples

ID:: 75372718

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1129127728.

Platr25 - P81S von Hippel-Lindau mutation effect on embryonic stem cell teratomas

Annotation:: Platr25, pluripotency associated transcript 25

Organism:: Mus musculus

Reporter:: GPL11533, 10409994 (ID_REF), GDS4865, BC032201, chr13:62800759-62807634 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 112912772

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 721124189.

Platr25 - Directed differentiation of embryonic stem cells and induced pluripotent stem cells

Annotation:: Platr25, pluripotency associated transcript 25

Organism:: Mus musculus

Reporter:: GPL6246, 10409994 (ID_REF), GDS3904, BC032201, chr13:62699399-62706274 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 72112418

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 750529610.

Platr25 - MPSS transcriptome analysis project

Annotation:: Platr25, pluripotency associated transcript 25

Organism:: Mus musculus

Reporter:: GPL1010, GATCTATGTGTGAAAGCCCA (ID_REF), GDS868, BC058422

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7505296

GEO DataSets Gene Chromosome neighbors

Select item 251843311.

Platr25 - Cardiac remodeling (Mu11K-A)

Annotation:: Platr25, pluripotency associated transcript 25

Organism:: Mus musculus

Reporter:: GPL75, aa474512_f_at (ID_REF), GDS387, 435366 (Gene ID), AA474512

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 2518433

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12960821812.

Platr25 - Retinoblastoma ∆G/∆G mutant allele effect on quiescent embryonic fibroblasts

Annotation:: Platr25, pluripotency associated transcript 25

Organism:: Mus musculus

Reporter:: GPL6246, 10409994 (ID_REF), GDS5641, BC032201, chr13:62699399-62706274 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 129608218

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 9903631813.

Platr25 - Spleen response to acute LCMV-Armstrong and persistent LCMV-Clone13 infections: time course

Annotation:: Platr25, pluripotency associated transcript 25

Organism:: Mus musculus

Reporter:: GPL6246, 10409994 (ID_REF), GDS4556, BC032201, chr13:62699399-62706274 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 26 samples

ID:: 99036318

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 2585476514.

Platr25 - Developing mammary gland: terminal end buds and ducts

Annotation:: Platr25, pluripotency associated transcript 25

Organism:: Mus musculus

Reporter:: GPL2660, 3765 (ID_REF), GDS2115, BC032201

DataSet type:: Expression profiling by array, log2 ratio, 12 samples

ID:: 25854765

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 7284698315.

Platr25 - Spatial and temporal development of mammalian salivary glands

Annotation:: Platr25, pluripotency associated transcript 25

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P372400 (ID_REF), GDS3922, BC032201, A_52_P372400 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72846983

GEO DataSets Gene Chromosome neighbors

Select item 13021897216.

Platr25 - Interleukin 7 and FLT-3 ligand effect on EML1 HSPC line expressing acute lymphoblastic leukemia TEL-AML1 fusion protein: time course

Annotation:: Platr25, pluripotency associated transcript 25

Organism:: Mus musculus

Reporter:: GPL11533, 10409994 (ID_REF), GDS5661, BC032201, chr13:62800759-62807634 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130218972

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 4142235117.

Platr25 - Nephronophthisis model

Annotation:: Platr25, pluripotency associated transcript 25

Organism:: Mus musculus

Reporter:: GPL2897, 263007 (ID_REF), GDS2817, BC058422

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41422351

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 589413318.

Platr25 - CD8 T cell development (Mu11K-A)

Annotation:: Platr25, pluripotency associated transcript 25

Organism:: Mus musculus

Reporter:: GPL75, aa474512_f_at (ID_REF), GDS728, 435366 (Gene ID), AA474512

DataSet type:: Expression profiling by array, count, 2 samples

ID:: 5894133

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 10509051819.

Platr25 - Retinoic acid deficiency effect on embryonic brain

Annotation:: Platr25, pluripotency associated transcript 25

Organism:: Mus musculus

Reporter:: GPL6246, 10409994 (ID_REF), GDS4836, BC032201, chr13:62699399-62706274 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 105090518

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 4682072420.

Platr25 - Dicer inactivation effect on the embryonic heart

Annotation:: Platr25, pluripotency associated transcript 25

Organism:: Mus musculus

Reporter:: GPL5025, 23224 (ID_REF), GDS3033, BC058422

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46820724

GEO DataSets Gene Profile neighbors Chromosome neighbors

<< First< Prev

Page of 16

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 435366) (308)
GEO Profiles
Krtap19-4 keratin associated protein 19-4 [Mus musculus]
Krtap19-4 keratin associated protein 19-4 [Mus musculus]
Gene ID:170654

Gene
PMC Links for GEO Profiles (Select 110784626) (11)
PMC

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 308

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity