GEO Profile Links for Gene (Select 21940) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 1032814461.

Cd27 - MEKK2 and MEKK3 deficiency effect on CD26L(low)CD44(high) CD4 T cells

Annotation:: Cd27, CD27 antigen

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3128992 (ID_REF), GDS4795, NM_001033126, CD27 (ORF)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 103281446

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1000646412.

Cd27 - APCΔ468 model of polyposis: regulatory T cells from various organs

Annotation:: Cd27, CD27 antigen

Organism:: Mus musculus

Reporter:: GPL6246, 10547985 (ID_REF), GDS4588, NM_001033126, NM_001286753, XM_006505900, BC139125, BC139126, L24495, NM_001042564, BC171931, AK137770, chr6:125232622-125237027 (SPOT ID)

DataSet type:: Expression profiling by array, count, 44 samples

ID:: 100064641

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 161502003.

Cd27 - Thymocyte response to anti-T cell receptor antibody stimulation

Annotation:: Cd27, CD27 antigen

Organism:: Mus musculus

Reporter:: GPL81, 102282_g_at (ID_REF), GDS1565, 21940 (Gene ID), L24495

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 16150200

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 886932844.

Cd27 - Activated diabetogenic CD8+ G9C8 clone cells and transgenic NOD/LtJ CD8 T cells

Annotation:: Cd27, CD27 antigen

Organism:: Mus musculus

Reporter:: GPL1261, 1452389_at (ID_REF), GDS4398, 21940 (Gene ID), L24495

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 88693284

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1326979465.

Cd27 - Diet-induced obesity model: white adipose tissue

Annotation:: Cd27, CD27 antigen

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3128992 (ID_REF), GDS6247, NM_001033126, CD27 (ORF)

DataSet type:: Expression profiling by array, transformed count, 40 samples

ID:: 132697946

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 239028006.

Cd27 - Thymocytes of the NOD background response to activation by a mimotope peptide

Annotation:: Cd27, CD27 antigen

Organism:: Mus musculus

Reporter:: GPL81, 102282_g_at (ID_REF), GDS2028, 21940 (Gene ID), L24495

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 23902800

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 697959847.

Cd27 - Retinoic acid effect on CD4+ T cells from spleen/lymph nodes

Annotation:: Cd27, CD27 antigen

Organism:: Mus musculus

Reporter:: GPL1261, 1452389_at (ID_REF), GDS3840, 21940 (Gene ID), L24495

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 69795984

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 30097008.

Cd27 - CD8+ effector and central memory T cells (MG-U74A)

Annotation:: Cd27, CD27 antigen

Organism:: Mus musculus

Reporter:: GPL81, 102282_g_at (ID_REF), GDS433, 21940 (Gene ID), L24495

DataSet type:: Expression profiling by array, count, 2 samples

ID:: 3009700

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1312047849.

Cd27 - FLT3/ITD-SmoM2 acute myeloid leukemia model: sorted bone marrow cells

Annotation:: Cd27, CD27 antigen

Organism:: Mus musculus

Reporter:: GPL1261, 1452389_at (ID_REF), GDS5806, 21940 (Gene ID), L24495

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131204784

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2930720010.

Cd27 - CD4/CD8 double positive thymocyte response to glucocorticoid

Annotation:: Cd27, CD27 antigen

Organism:: Mus musculus

Reporter:: GPL81, 102282_g_at (ID_REF), GDS2266, 21940 (Gene ID), L24495

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 29307200

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12090271711.

Cd27 - T helper type 9 cells

Annotation:: Cd27, CD27 antigen

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P229664 (ID_REF), GDS5291, NM_001033126, A_51_P229664 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 120902717

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11440494112.

Cd27 - Transforming growth factor beta effect on cytokine-activated, NOD-derived, splenic natural killer cells

Annotation:: Cd27, CD27 antigen

Organism:: Mus musculus

Reporter:: GPL6246, 10547985 (ID_REF), GDS4948, NM_001033126, NM_001286753, XM_006505900, BC139125, BC139126, L24495, NM_001042564, BC171931, AK137770, chr6:125232622-125237027 (SPOT ID)

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 114404941

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11436824113.

Cd27 - Regulatory T cell ablation effect on BDC2.5/NOD pancreatic or splenic natural killer cells: time course

Annotation:: Cd27, CD27 antigen

Organism:: Mus musculus

Reporter:: GPL6246, 10547985 (ID_REF), GDS4946, NM_001033126, NM_001286753, XM_006505900, BC139125, BC139126, L24495, NM_001042564, BC171931, AK137770, chr6:125232622-125237027 (SPOT ID)

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 114368241

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8442668414.

Cd27 - Natural and induced Foxp3+ regulatory T cells and Foxp3-deficient induced regulatory T cells

Annotation:: Cd27, CD27 antigen

Organism:: Mus musculus

Reporter:: GPL1261, 1452389_at (ID_REF), GDS4364, 21940 (Gene ID), L24495

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 84426684

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8358418415.

Cd27 - Non-obese diabetic (NOD) and disease-resistant NOD.NOR-Chr4 models: splenic B cells

Annotation:: Cd27, CD27 antigen

Organism:: Mus musculus

Reporter:: GPL1261, 1452389_at (ID_REF), GDS4340, 21940 (Gene ID), L24495

DataSet type:: Expression profiling by array, transformed count, 11 samples

ID:: 83584184

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10785284116.

Cd27 - Estrogen effect on male and female haematopoietic stem cells

Annotation:: Cd27, CD27 antigen

Organism:: Mus musculus

Reporter:: GPL6246, 10547985 (ID_REF), GDS4944, NM_001033126, NM_001286753, XM_006505900, BC139125, BC139126, L24495, NM_001042564, BC171931, AK137770, chr6:125232622-125237027 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 107852841

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 747504617.

Cd27 - MPSS transcriptome analysis project

Annotation:: Cd27, CD27 antigen

Organism:: Mus musculus

Reporter:: GPL1010, GATCGAAACCAGCTGTAACT (ID_REF), GDS868, BY761889

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7475046

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 7396768418.

Cd27 - MMTV/c-MYC transgenic model of breast cancer: peripheral blood cells

Annotation:: Cd27, CD27 antigen

Organism:: Mus musculus

Reporter:: GPL1261, 1452389_at (ID_REF), GDS3953, 21940 (Gene ID), L24495

DataSet type:: Expression profiling by array, transformed count, 93 samples

ID:: 73967684

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10176374119.

Cd27 - Hematopoietic cell response to Xist deficiency in females: time course

Annotation:: Cd27, CD27 antigen

Organism:: Mus musculus

Reporter:: GPL6246, 10547985 (ID_REF), GDS4755, NM_001033126, NM_001286753, XM_006505900, BC139125, BC139126, L24495, NM_001042564, BC171931, AK137770, chr6:125232622-125237027 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 20 samples

ID:: 101763741

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6637378420.

Cd27 - Transcription factor SRF deletion effect on hematopoietic stem cells

Annotation:: Cd27, CD27 antigen

Organism:: Mus musculus

Reporter:: GPL1261, 1452389_at (ID_REF), GDS3732, 21940 (Gene ID), L24495

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 66373784

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 21940) (1000)
GEO Profiles
Genes with a similar H3K4me3 profile for Gene (Select 10404) (5)
Gene
Nucleotide Links for Gene (Select 10404) (26)
Nucleotide

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity