GEO Profile Links for Gene (Select 11651) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 341895061.

Akt1 - Breast cancer formation in WAP-SVT/t transgenic animals

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL339, 1425711_a_at (ID_REF), GDS2514, 11651 (Gene ID), M94335

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 34189506

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1295557882.

Akt1 - Double-knockout p53/PRKDC model of B cell acute lymphoblastic leukemia: leukemic blasts

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL1261, 1416657_at (ID_REF), GDS5640, 11651 (Gene ID), NM_009652

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 129555788

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1295648173.

Akt1 - Double-knockout p53/PRKDC model of B cell acute lymphoblastic leukemia: leukemic blasts

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL1261, 1425711_a_at (ID_REF), GDS5640, 11651 (Gene ID), M94335

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 129564817

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 618571174.

Akt1 - Isoproterenol-induced cardiomyopathy and exercise-induced cardiac hypertrophy

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL1261, 1425711_a_at (ID_REF), GDS3596, 11651 (Gene ID), M94335

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 61857117

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 341805885.

Akt1 - Breast cancer formation in WAP-SVT/t transgenic animals

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL339, 1416657_at (ID_REF), GDS2514, 11651 (Gene ID), NM_009652

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 34180588

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1303548416.

Akt1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 9841 (ID_REF), GDS5664, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130354841

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76292997.

Akt1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCATCTGAACCTGATGTT (ID_REF), GDS878, NM_009652

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7629299

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 736796888.

Akt1 - Trophoblast stem cell differentiation in vitro

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL1261, 1416657_at (ID_REF), GDS3948, 11651 (Gene ID), NM_009652

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 73679688

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1303494679.

Akt1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 4467 (ID_REF), GDS5664, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130349467

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13034953410.

Akt1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 4534 (ID_REF), GDS5664, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130349534

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13034996811.

Akt1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 4968 (ID_REF), GDS5664, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130349968

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13036014912.

Akt1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 15149 (ID_REF), GDS5664, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130360149

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13036084313.

Akt1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 15843 (ID_REF), GDS5664, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130360843

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13036731614.

Akt1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 22316 (ID_REF), GDS5664, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130367316

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13036880415.

Akt1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 23804 (ID_REF), GDS5664, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130368804

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13037902516.

Akt1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 34025 (ID_REF), GDS5664, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130379025

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13038916917.

Akt1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 44169 (ID_REF), GDS5664, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130389169

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12703773418.

Akt1 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 4534 (ID_REF), GDS5461, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127037734

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12704304119.

Akt1 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 9841 (ID_REF), GDS5461, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127043041

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12703816820.

Akt1 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Akt1, thymoma viral proto-oncogene 1

Organism:: Mus musculus

Reporter:: GPL4134, 4968 (ID_REF), GDS5461, NM_009652, A_51_P237553 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127038168

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 11651) (1000)
GEO Profiles
Mus musculus thymoma viral proto-oncogene 1 (Akt1), transcript variant 4, mRNA
Mus musculus thymoma viral proto-oncogene 1 (Akt1), transcript variant 4, mRNA
gi|2273809915|ref|NM_001409449.1|

Nucleotide
Mus musculus thymoma viral proto-oncogene 1 (Akt1), transcript variant 10, non-c...
Mus musculus thymoma viral proto-oncogene 1 (Akt1), transcript variant 10, non-coding RNA
gi|2273809955|ref|NR_176843.1|

Nucleotide

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity