GEO Profile Links for Gene (Select 100503849) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 913

<< First< Prev

Page of 46

Next >Last >>

Select item 890243681.

Sp3os - Nitric oxide generator DETA-NONOate effect on in vitro neuronal injury model: time course

Annotation:: Sp3os, trans-acting transcription factor 3, opposite strand

Organism:: Mus musculus

Reporter:: GPL1261, 1439162_at (ID_REF), GDS4408, 100503849 (Gene ID), AV212852

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 89024368

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 866969682.

Sp3os - All-trans retinoic acid effect on retinoic acid receptor α-deficient F9 teratocarcinoma cells

Annotation:: Sp3os, trans-acting transcription factor 3, opposite strand

Organism:: Mus musculus

Reporter:: GPL1261, 1439162_at (ID_REF), GDS4294, 100503849 (Gene ID), AV212852

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 86696968

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 280011683.

Sp3os - Spinal cord and dorsal root ganglion

Annotation:: Sp3os, trans-acting transcription factor 3, opposite strand

Organism:: Mus musculus

Reporter:: GPL1261, 1439162_at (ID_REF), GDS2209, 100503849 (Gene ID), AV212852

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 28001168

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 847193924.

Sp3os - DSS-induced colitis model response to enhanced siRNA targeting of Tumor necrosis factor α

Annotation:: Sp3os, trans-acting transcription factor 3, opposite strand

Organism:: Mus musculus

Reporter:: GPL6246, 10472925 (ID_REF), GDS4371, NR_045269, chr2:72979432-72988601 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 84719392

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1078447925.

Sp3os - Estrogen effect on male and female haematopoietic stem cells

Annotation:: Sp3os, trans-acting transcription factor 3, opposite strand

Organism:: Mus musculus

Reporter:: GPL6246, 10472925 (ID_REF), GDS4944, NR_045269, chr2:72979432-72988601 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 107844792

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 74633356.

1700011J10Rik - MPSS transcriptome analysis project

Annotation:: 1700011J10Rik, RIKEN cDNA 1700011J10 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTCTTGTTCCACGATG (ID_REF), GDS868, BX526917

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7463335

GEO DataSets Gene Chromosome neighbors

Select item 1284473967.

Sp3os - Sirtuin-1 activator resveratrol effect on adult secondary neurospheres

Annotation:: Sp3os, trans-acting transcription factor 3, opposite strand

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P137481 (ID_REF), GDS5612, AK005870, A_51_P137481 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 128447396

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1320603928.

Sp3os - Nebulin deficiency effect on the soleus

Annotation:: Sp3os, trans-acting transcription factor 3, opposite strand

Organism:: Mus musculus

Reporter:: GPL6246, 10472925 (ID_REF), GDS5881, NR_045269, chr2:72979432-72988601 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 132060392

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1284047969.

Sp3os - Sirtuin-1 deficiency effect on adult secondary neurospheres

Annotation:: Sp3os, trans-acting transcription factor 3, opposite strand

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P137481 (ID_REF), GDS5611, AK005870, A_51_P137481 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 128404796

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 10469489210.

Sp3os - Tropomodulin3 deficiency effect on the fetal liver

Annotation:: Sp3os, trans-acting transcription factor 3, opposite strand

Organism:: Mus musculus

Reporter:: GPL6246, 10472925 (ID_REF), GDS4827, NR_045269, chr2:72979432-72988601 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 104694892

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 11881279611.

Sp3os - Transcription factor engrailed-2 loss-of-function model of autism spectrum disorder: cerebellum

Annotation:: Sp3os, trans-acting transcription factor 3, opposite strand

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P137481 (ID_REF), GDS5241, AK005870, A_51_P137481 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 118812796

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 8749659212.

Sp3os - Iroquois homeobox Irx3 and Irx5 deletion effect on embryonic heart

Annotation:: Sp3os, trans-acting transcription factor 3, opposite strand

Organism:: Mus musculus

Reporter:: GPL6246, 10472925 (ID_REF), GDS4317, NR_045269, chr2:72979432-72988601 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 87496592

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 8808459213.

Sp3os - B7x effect on CD8 T cell-mediated diabetes model AI4αβ: pancreatic CD8 T cells

Annotation:: Sp3os, trans-acting transcription factor 3, opposite strand

Organism:: Mus musculus

Reporter:: GPL6246, 10472925 (ID_REF), GDS4334, NR_045269, chr2:72979432-72988601 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 88084592

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 13240339214.

Sp3os - Arthritic tarsal joints induced by collagen: time course

Annotation:: Sp3os, trans-acting transcription factor 3, opposite strand

Organism:: Mus musculus

Reporter:: GPL6246, 10472925 (ID_REF), GDS6064, NR_045269, chr2:72979432-72988601 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 15 samples

ID:: 132403392

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 11585719215.

Sp3os - Neuro2a neuroblastoma cell lines: anchorage dependent cells and anchorage independent tumorspheres

Annotation:: Sp3os, trans-acting transcription factor 3, opposite strand

Organism:: Mus musculus

Reporter:: GPL6246, 10472925 (ID_REF), GDS5140, NR_045269, chr2:72979432-72988601 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 115857192

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 170442316.

Sp3os - Ligand screen in B cells: B-cell activating factor

Annotation:: Sp3os, trans-acting transcription factor 3, opposite strand

Organism:: Mus musculus

Reporter:: GPL260, 5241 (ID_REF), GDS293, AK005870

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 1704423

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 103751917.

Sp3os - Platform type/amplification method cross comparison (16K cDNA)(I)

Annotation:: Sp3os, trans-acting transcription factor 3, opposite strand

Organism:: Mus musculus

Reporter:: GPL260, 2950 (ID_REF), GDS224, AK013593

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 1037519

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 11226936818.

Sp3os - Cystatin B knockout model of progressive myoclonus epilepsy: postnatal day 30 cerebellum

Annotation:: Sp3os, trans-acting transcription factor 3, opposite strand

Organism:: Mus musculus

Reporter:: GPL1261, 1439162_at (ID_REF), GDS5090, 100503849 (Gene ID), AV212852

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 112269368

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 13229929619.

Sp3os - Transcription factor engrailed-2 loss-of-function model of autism spectrum disorder: hippocampus

Annotation:: Sp3os, trans-acting transcription factor 3, opposite strand

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P137481 (ID_REF), GDS6016, AK005870, A_51_P137481 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 132299296

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 13202369220.

Sp3os - Nebulin deficiency effect on the quadriceps

Annotation:: Sp3os, trans-acting transcription factor 3, opposite strand

Organism:: Mus musculus

Reporter:: GPL6246, 10472925 (ID_REF), GDS5880, NR_045269, chr2:72979432-72988601 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 132023692

GEO DataSets Gene Profile neighbors Chromosome neighbors

<< First< Prev

Page of 46

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 100503849) (913)
GEO Profiles
Taxonomy Links for Protein (Select 2302515429) (1)
Taxonomy
Taxonomy Links for Nucleotide (Select 73779916) (1)
Taxonomy
Spleen response to acute LCMV-Armstrong and persistent LCMV-Clone13 infections: ...
Spleen response to acute LCMV-Armstrong and persistent LCMV-Clone13 infections: time course
Accession: GDS4556

GEO DataSets
Related DataSets for GEO Profiles (Select 99038552) (1)
GEO DataSets

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 913

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity