|
| Status |
Public on Dec 26, 2012 |
| Title |
ShKdm2b replicate 4 |
| Sample type |
RNA |
| |
|
| Source name |
mouse embryonic stem cells
|
| Organism |
Mus musculus |
| Characteristics |
cell type: embryonic stem cells
shRNA: shKdm2b
shRNA sequence: CGCTGTGGAAATATCTGTCAT
passages: p30
strain: E14
|
| Treatment protocol |
samples were collected in parallel in 4 biological independent replicates
|
| Growth protocol |
regular ES media supplemented with 10 ng/mL LIF
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA extraction (Rneasy mini kit) + DNAse treatment
|
| Label |
biotin
|
| Label protocol |
Sense ssDNA was fragmented and labeled using the GeneChip® WT Terminal Labeling and Controls Kit.
|
| |
|
| Hybridization protocol |
The labeled ssDNA was hybridized to Affymetrix Mouse Gene 1.0 ST Array (Affymetrix)
|
| Scan protocol |
Chips were processed on an Affymetrix GeneChip Fluidics Station 450 and Scanner 3000
|
| Description |
Gene expression data from mESC stably expressing shRNA targeting Kdm2b
|
| Data processing |
Data were analyzed using the oligo (v1.18.1) R/Biocondutor package and normalized using the RMA algorithm
|
| |
|
| Submission date |
Sep 07, 2012 |
| Last update date |
Dec 26, 2012 |
| Contact name |
Ian Sudbery |
| E-mail(s) |
i.sudbery@sheffield.ac.uk
|
| Organization name |
University of Sheffield
|
| Department |
Molecular Biology and Biotechnology
|
| Lab |
Sudbery Lab for Computational Genomics
|
| Street address |
Firth Court, Western Bank
|
| City |
Sheffield |
| ZIP/Postal code |
S11 8HG |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL6246 |
| Series (2) |
| GSE40701 |
Gene expression changes following knockdown of Kdm2b on mESCs |
| GSE41267 |
KDM2B links the Polycomb Repressive Complex 1 (PRC1) to recognition of CpG islands |
|
