 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Dec 02, 2023 |
| Title |
thioridazine-treated, large group, stage 35, sample 3 |
| Sample type |
SRA |
| |
|
| Source name |
whole embryo
|
| Organism |
Xenopus laevis |
| Characteristics |
tissue: whole embryo
developmental stage: Stage 35
genotype: WT
treatment: thioridazine
|
| Treatment protocol |
Stage 25 embryos (reared at 14°C prior to exposure) were treated with 90 µM thioridazine in 0.1x MMR from NF stage 12.5 to 35. During the treatment, experimental and control embryos were kept at 18°C.
|
| Growth protocol |
Xenopus laevis embryos were fertilized in vitro according to standard protocols in 0.1X Marc’s Modified Ringer’s solution and kept at 14°C.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
A sample consisted of 15 pooled tadpoles from each treatment and each was repeated 3 times. Tissue was extracted using TRIzol (Thermo Fisher Scientific) as per the manufacturer’s protocol, and total RNA quality and quantity was assessed using a NanoDrop spectrophotometer (Thermo Fisher Scientific).
RNA library preparation was done with the Illumina Stranded Total RNA with Ribo-Zero Plus. Libraries were then multiplexed, and an rRNA depletion run using single-end, 75-nucleotide sequencing was performed on Illumina HiSeq 2500.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
Thio300C9_S9
|
| Data processing |
Trim adapter and polyX tails: The RNA-seq raw reads are single-end reads. The reads were trimmed for adapter “CTGTCTCTTATACACATCTCCGAGCCCACGAGAC” and polyX tails, then filtered by sequencing Phred quality (>= Q15) usingfastp(Chen et al. 2018).
Read alignment to rRNA: We downloaded theXenopus laevisrRNA sequences NCBI nucleotide database. Bowtie2 index was build by using thebowtie2-buildmodule(Langmead and Salzberg 2012). We aligned the adapter-trimmed reads to Xenopus laevis rRNA using Bowtie2 (Langmead and Salzberg 2012). We extracted the reads that were not mapped toXenopus laevisrRNA usingsamtools(H. Li et al. 2009).
Aligning reads to the genome: We downloaded theXenopus laevisgenome sequences and gene annotation from theNCBI genome database, version 10.1. We then used thegenomeGeneratemodule of theSTARaligner(Dobin et al. 2013)to generate the genome indexes. We setSTARaligner option sjdbOverhang = 75 for 76-bp reads, as was ideal. We aligned the adapter-trimmed reads to the genome using STAR aligner with the two-pass option. Reads were mapped across the genome to identify novel splice junctions in the first-pass. These new annotations were then incorporated into the reference indexes and reads were re-aligned with this new reference in the second pass. While more time-intensive, this step could aid in aligning across these junctions, especially in organisms where the transcriptome was not as well annotated. To estimate the gene expression from the gene alignments, we used RSEM, a tool for accurate quantification of gene and isoform expression from RNA-Seq data (B. Li and Dewey 2011). The resulted gene count table is at rsem_gene_counts.tsv.
Filtering, normalization, and transformation: To filter out low expressing genes, we kept genes that had counts per million (CPM) more than 1.8 in at least 3 samples. There were 21720 genes after filtering. We then normalized counts by weighted trimmed mean of M-values (TMM)(Robinson and Oshlack 2010). If no normalization is needed, all the normalization factors would be 1. Here the normalization factors were between 0.94 and 1.05. To use linear models in the following analysis, we performed Voom transformation(Law et al. 2014)to transform counts into logCPM.
Differential expression analysis: To discover the differential genes, we uselimma, an R package that powers differential expression analyses(Ritchie et al. 2015). We performed moderated t-tests to detect genes that were differentially expressed
Assembly: Xenopus laevis (NCBI genome database, version 10.1)
Supplementary files format and content: tab-delimited file includes a gene count table
Supplementary files format and content: tab-delimited file includes logCPM normalized values
|
| |
|
| Submission date |
Oct 19, 2023 |
| Last update date |
Dec 02, 2023 |
| Contact name |
Megan M Sperry |
| Organization name |
Wyss Institute at Harvard University
|
| Street address |
3 Blackfan Circle
|
| City |
Boston |
| State/province |
MA |
| ZIP/Postal code |
02115-5713 |
| Country |
USA |
| |
|
| Platform ID |
GPL18936 |
| Series (2) |
| GSE245781 |
Embryos Assist Each Other’s Morphogenesis: calcium and ATP signaling mechanisms in collective resistance to teratogens (Stage 35) |
| GSE245782 |
Embryos Assist Each Other’s Morphogenesis: calcium and ATP signaling mechanisms in collective resistance to teratogens |
|
| Relations |
| BioSample |
SAMN37883709 |
| SRA |
SRX22145124 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
|
|
|
|
 |
