 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 26, 2023 |
| Title |
ATAC_dpse_ovary_rep2 |
| Sample type |
SRA |
| |
|
| Source name |
ovary
|
| Organism |
Drosophila pseudoobscura |
| Characteristics |
tissue: ovary
genotype: wild type
Sex: female
|
| Treatment protocol |
N/A
|
| Growth protocol |
All Drosophila species were maintained at room temperature on species-specific food.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
The freshly dissected instact ovaries were directly lysed in ATAC-Resuspension Buffer (RSB, 10 mM Tris-HCL pH 7.4, 10 mM NaCl, 3 mM MgCl2 in nuclease free water) containing 0.1% NP40, 0.1% Tween20, and 0.01% Digitonin and washed out with cold ATAC-RSB containing 0.1% Tween-20.
The transposition reaction was performed with 25 μl 2x TD buffer from and 2.5 μl transposase (100nM final) from Illumina Tagment DNA Enzyme and Buffer Small Kit (Illumina 20034197), 16.5 μl PBS, 0.5 μl 1% digitonin, 0.5 μl 10% Tween-20, 5 μl H2O at 37°C for 30 minutes in a thermomixer with 1000 RPM mixing. Zymo DNA Clean and Concentrator-5 Kit (cat# D4014) was used for a clean-up. The transposed fragments were amplified for 5 cycles [72 °C for 5 min, 98 °C for 30 s (98 °C for 10 s, 63 °C for 30 s, 72 °C for 1 min) × 5] using NEBNext 2x MasterMix and primer pairs of the universal primer Ad1 and the index primers Ad2. This was followed by qPCR amplification to determine additional cycle number. Amplified DNA was purified using Zymo DNA Clean and Concentrator-5 Kit (cat# D4014) and eluted in 20 μl H2O. AMPure XP beads (Beckman Coulter) were used for double-sided bead purification. 100-600 bp fragments were selected using Blue Pippin (Sage Science).
|
| |
|
| Library strategy |
ATAC-seq |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Description |
10-12 ovaries
|
| Data processing |
genome build/assembly: GCF_009870125
The paired-end reads were trimmed of adapter sequences TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG and GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG using Cutadapt tool (v1.18; default parameters).
Burrows-Wheeler Aligner (BWA) (v0.7.17, bwa mem -M -t 4) was used to align the trimmed paired reads to each genome assembly.
Duplicates were marked using Picard tool (v2.9.0) (MarkDuplicates, validation stringency=lenient). SAMtools (v1.9) was used for indexing and filtering. The quality metrics for the aligned ATAC-seq reads were assessed using ataqv (v1.0.0)
The ATAC-seq peaks were called with MACS2 (v2.1.1.20160309) using --nomodel --shift -37 --extsize 73 parameters and FDR cut-off q ≤ 0.05
Conservation of ATAC-seq peaks were assessed by performing LiftOver (UCSC) or NCBI BLAST+ (2.14.0 release) of the ATAC-seq peak regions to find orthologous genomic regions in the other species and checking if they also have an ATAC-seq peak in that region.
Supplementary files format and content: RPKM-normalized bigWig files for each sample and RPKM-normalized bigWig files of merged biological replicates
Supplementary files format and content: narrowPeak files of ATAC-seq peaks from MACS2
|
| |
|
| Submission date |
Aug 15, 2023 |
| Last update date |
Sep 26, 2023 |
| Contact name |
Susanne Bornelöv |
| E-mail(s) |
susanne.bornelov@cruk.cam.ac.uk
|
| Organization name |
University of Cambridge
|
| Department |
Cancer Research UK - Cambridge Institute
|
| Lab |
Hannon
|
| Street address |
Robinson Way
|
| City |
Cambridge |
| ZIP/Postal code |
CB2 0RE |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL22420 |
| Series (2) |
| GSE225889 |
Unistrand piRNA clusters are an evolutionarily conserved mechanism to suppress endogenous retroviruses across the Drosophila genus |
| GSE240910 |
Unistrand piRNA clusters are an evolutionarily conserved mechanism to suppress endogenous retroviruses across the Drosophila genus [ATAC-Seq] |
|
| Relations |
| BioSample |
SAMN36996895 |
| SRA |
SRX21375761 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7711968_ATAC.dpse.GCF_009870125.rep2.bw |
48.9 Mb |
(ftp)(http) |
BW |
| GSM7711968_ATAC.dpse.GCF_009870125.rep2.narrowPeak.gz |
550.8 Kb |
(ftp)(http) |
NARROWPEAK |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
