 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Dec 15, 2011 |
| Title |
stage HH10 chicken embryos |
| Sample type |
SRA |
| |
|
| Source name |
whole embryo
|
| Organism |
Gallus gallus |
| Characteristics |
breed: Lingnan Yellow
developmental stage: stage HH10
tissue: embryo
|
| Treatment protocol |
Chicken eggs were wiped with 70% ethanol before manipulation of the embryos
|
| Growth protocol |
The stage X chicken embryos were isolated from freshly laid fertile unincubated chicken eggs; HH10 chicken embryos were obtained by incubating the fertile chicken eggs at 37.8°C under humid conditions for about 30 hr
|
| Extracted molecule |
total RNA |
| Extraction protocol |
After removal of the amnion, embryos were rinsed in DEPC-treated 0.75% NaCl solution, and immediately processed for RNA isolation using Trizol reagent (Invitrogen) according to the manufacturer's manual. Small RNAs ranging from 18 to 33nt were gel-purified and ligated to the 3' adaptor (5'-pUCGUAUGCCGUCUUCUGCUUGUidT-3'; p, phosphate; idT, inverted deoxythymidine) and 5' adaptor (5'-GUUCAGAGUUCUACAGUCCGACGAUC-3'). Ligation products were gel-purified, reverse transcribed, and amplified using Illumina's sRNA primer set (5'-CAAGCAGAAGACG GCATACGA-3'; 5'-AATGATACGGCGACCACCGA-3'). Samples were sequenced on an Illumina 1G Genome Analyzer.
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer |
| |
|
| Data processing |
txt: The 3' linker, CTGTAGGCACCATCAAT, was identified and stripped out of the raw reads using a dynamic programming algorithm, which request at least 5nt overlap between 35nt reads and 3' adaptor sequence.
|
| |
|
| Submission date |
Apr 15, 2011 |
| Last update date |
May 15, 2019 |
| Contact name |
Peng Shao |
| E-mail(s) |
lsssp@mail.sysu.edu.cn
|
| Phone |
86-20-84112517
|
| Fax |
86-20-84112399
|
| Organization name |
Sun Yat-sen University
|
| Department |
School of Life Sciences
|
| Street address |
No. 135, Xingangxi Road
|
| City |
Guangzhou |
| State/province |
Guangdong |
| ZIP/Postal code |
510275 |
| Country |
China |
| |
|
| Platform ID |
GPL10223 |
| Series (1) |
| GSE28668 |
High-throughput sequencing of small RNAs from chicken embryos |
|
| Relations |
| SRA |
SRX058634 |
| BioSample |
SAMN00260303 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM710258_stage_HH10_chicken_embryo.txt.gz |
4.9 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
