 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 26, 2023 |
| Title |
Dere.ovary_FC.2 small-RNA-Seq |
| Sample type |
SRA |
| |
|
| Source name |
Dere.ovary_FC.2
|
| Organism |
Drosophila erecta |
| Characteristics |
tissue: ovary
enrichment: somatic follicle cells
assembly: d101g,d15genomes,droEre1,GCF_003286155
|
| Treatment protocol |
N/A
|
| Growth protocol |
All Drosophila species were maintained at room temperature on species-specific food.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Small RNAs were isolated using the TraPR Small RNA Isolation Kit (Lexogen) following the manufacturer's instructions. The soma-enrichment sRNA-seq libraries were generated for 13 species (2 replicates each) similar to published protocols (Akkouche et al., 2013; Chirn et al., 2015), with modifications. In brief, 75-100 ovary pairs were dissected in ice-cold PBS. Ovaries were dissociated for 18 minutes in 0.25% Trypsin (Sigma-Aldrich) at 25˚C, shaking at 800 rpm. Dissociated tissue was pushed through a 40 µm nylon mesh (Greiner Bio-one) washed with equal volume Schneider 2 medium (Thermo Fisher Scientific) and then pelleted. Cell count was quantified using the Luna-FL (Logos Biosystems). Cells were pelleted and directly used as input for sRNA isolation using the TraPR Small RNA Isolation Kit (Lexogen).
sRNA libraries were generated using the Small RNA-Seq Library Prep Kit (Lexogen) with minor modifications. Both primers A3 and A5 as well as the primer RTP were used at 0.5x.
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Description |
Dere.ovary_FC.unox.SLX-22038-2.1
|
| Data processing |
Trim Galore! (v0.6.4, --stringency 30 -e 0.1 -a TGCTTGGACTACATATGGTTGAGGGTTGTA --length 18 -q 0) was first run to remove an abundant rRNA sequence, followed by a second run (--stringency 5 -e 0.1 --length 18 --max_length 35 -q 0) to remove adapter sequences (specified using ‘-a’), and any flanking random nucleotides (‘--clip_R1’ and/or ‘--three_prime_clip_R1’ with appropriate arguments).
The processed reads were mapped to a miRNA hairpin database (miRBase release 22.1) using bowtie (v1.2.3, -S -n 2 -M 1 -p 20 --best --strata --nomaqround --chunkmbs 1024) with ‘--un’ and ‘--max’ to extract unmapped reads.
Reads not mapping to miRNAs were aligned to the respective reference genomes using bowtie (-S -n 2 -M 1 -p 20 --best --strata --nomaqround --chunkmbs 1024).
Multi-mapping reads were extracted into a separate BAM file using awk (MQ<10).
The BAM files were converted to bigWig using bamCoverage from deepTools (Ramírez et al., 2016) (v3.3.2, --binSize 1 --ignoreForNormalization chrM --normalizeUsing CPM --exactScaling --skipNonCoveredRegions --minFragmentLength 23 --maxFragmentLength 30) and additionally ‘--filterRNAstrand’ to separate the two strands, ‘---scaleFactor’ to scale counts per million to reflect all mapped reads, and optionally ‘--minMappingQuality 50’ when extracting uniquely mapped reads.
Supplementary files format and content: bigWig showing read coverage per position. File name indicate species, genome assembly, strand, and sample.
|
| |
|
| Submission date |
Feb 22, 2023 |
| Last update date |
Sep 26, 2023 |
| Contact name |
Susanne Bornelöv |
| E-mail(s) |
susanne.bornelov@cruk.cam.ac.uk
|
| Organization name |
University of Cambridge
|
| Department |
Cancer Research UK - Cambridge Institute
|
| Lab |
Hannon
|
| Street address |
Robinson Way
|
| City |
Cambridge |
| ZIP/Postal code |
CB2 0RE |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL33164 |
| Series (2) |
| GSE225888 |
Unistrand piRNA clusters are an evolutionarily conserved mechanism to suppress endogenous retroviruses across the Drosophila genus [small RNA-Seq] |
| GSE225889 |
Unistrand piRNA clusters are an evolutionarily conserved mechanism to suppress endogenous retroviruses across the Drosophila genus |
|
| Relations |
| BioSample |
SAMN33419767 |
| SRA |
SRX19478070 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7059854_Dere.GCF_003286155.minus.ovary_FC.unox.SLX-22038-2.uniq.23-30.bw |
201.9 Kb |
(ftp)(http) |
BW |
| GSM7059854_Dere.GCF_003286155.plus.ovary_FC.unox.SLX-22038-2.uniq.23-30.bw |
242.8 Kb |
(ftp)(http) |
BW |
| GSM7059854_Dere.d101g.minus.ovary_FC.unox.SLX-22038-2.uniq.23-30.bw |
220.4 Kb |
(ftp)(http) |
BW |
| GSM7059854_Dere.d101g.plus.ovary_FC.unox.SLX-22038-2.uniq.23-30.bw |
263.0 Kb |
(ftp)(http) |
BW |
| GSM7059854_Dere.d15genomes.minus.ovary_FC.unox.SLX-22038-2.uniq.23-30.bw |
213.6 Kb |
(ftp)(http) |
BW |
| GSM7059854_Dere.d15genomes.plus.ovary_FC.unox.SLX-22038-2.uniq.23-30.bw |
254.1 Kb |
(ftp)(http) |
BW |
| GSM7059854_Dere.droEre1.minus.ovary_FC.unox.SLX-22038-2.uniq.23-30.bw |
313.5 Kb |
(ftp)(http) |
BW |
| GSM7059854_Dere.droEre1.plus.ovary_FC.unox.SLX-22038-2.uniq.23-30.bw |
349.4 Kb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
