|
| Status |
Public on Oct 16, 2022 |
| Title |
Pro_noN_3 |
| Sample type |
SRA |
| |
|
| Source name |
Saccharomyces cerevisiae (BY)
|
| Organism |
Saccharomyces cerevisiae |
| Characteristics |
cell type: yeast cells
genotype: prototrophic WT
treatment: deplete with nitrogen for 4 hr
|
| Treatment protocol |
Treatment is indicated above
|
| Growth protocol |
Grown in indicated media overnight and harvested between OD=0.2-0.4, with a total OD of 5 per sample.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Direct-zol RNA Miniprep
After the QC procedures, mRNA from eukaryotic organisms is enriched from total RNA using oligo(dT) beads. The mRNA is then fragmented randomly in fragmentation buffer, followed by cDNA synthesis using random hexamers and reverse transcriptase. After first-strand synthesis, a custom second-strand synthesis buffer (Illumina) is added, with dNTPs, RNase H and Escherichia coli polymerase I to generate the second strand by nick-translation and AMPure XP beads is used to purify the cDNA. The final cDNA library is ready after a round of purification, terminal repair, Atailing, ligation of sequencing adapters, size selection and PCR enrichment. Library concentration was first quantified using a Qubit 2.0 fluorometer (Life Technologies), and then diluted to I ng/gl before checking insert size on an Agilent 2100 and quantifying to greater accuracy by quantitative PCR (Q-PCR) (library activity >2 nM).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Description |
150 x 150 cycle paired end sequence
|
| Data processing |
Libraries are fed into Novaseq6000 machines according to activity and expected data volume. A paired-end 150 bp sequencing strategy was used and all samples were sequenced to at least 6 Gb.
XPRESSpipe v0.6.3 was used to process sequence files, with the following command: xpresspipe peRNAseq ... -a AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGATGACTATCTCGTATGCCGTCTTCTGCTTG --sjdbOverhang 149 --quantification_method htseq --remove_rrna. See supplementary files for XPRESSpipe dependencies and settings used.
Assembly: Ensembl Saccharomyces_cerevisiae release-106
Supplementary files format and content: Tab-delimited text file - processed count data
|
| |
|
| Submission date |
Sep 06, 2022 |
| Last update date |
Oct 16, 2022 |
| Contact name |
Jordan A Berg |
| E-mail(s) |
jordan.berg@biochem.utah.edu
|
| Organization name |
University of Utah
|
| Department |
Biochemistry
|
| Lab |
Jared Rutter
|
| Street address |
15 N Medical Drive East, Rm 5520
|
| City |
Salt Lake City |
| State/province |
UT |
| ZIP/Postal code |
84112 |
| Country |
USA |
| |
|
| Platform ID |
GPL27812 |
| Series (1) |
| GSE212790 |
Sequencing of yeast mutants with or without phosphate depletion |
|
| Relations |
| BioSample |
SAMN30693193 |
| SRA |
SRX17448878 |
