GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM5737594

Query DataSets for GSM5737594

Status

Public on May 16, 2024

Title

MT4 +ADPRC -HIV rep4

Sample type

SRA

Source name

human CD4 + T-cell line MT4

Organism

Homo sapiens

Characteristics

cell line: MT4
cell type: CD4 + T-cell
infection: no HIV-1
treatment: ADPRC
sample type: NAD-capped RNA
rna fraction: short RNA

Treatment protocol

MT4 cells were infected with a cell-free HIV-1 strain NL4-3, which was generated by transient transfection of HEK293T cells with a pNL4-3 plasmid (obtained through NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH from Dr. Malcolm Martin). The infected cultures were subsequently expanded by co-cultivation: 48 h post-infection, cell culture supernatants containing viral particles and infected cells were added to uninfected MT-4 cells (5*105 cells per mL) at a ratio of 1:9. The co-culture was synchronized by three successive additions of infected culture supernatant to uninfected MT-4 cells (5*105 cells per mL, the ratio of 1:9, 27 h interval). The cell cultures were incubated for additional 40 hours and then harvested.

Growth protocol

MT4 cell line was cultured in RPMI 1640 with L-Glutamine and 25 mM Hepes supplemented with 10% FBS, penicillin (100 U/mL) and streptomycin (100 μg/mL) (all Sigma-Aldrich), under standard conditions at 37 °C under a humidified (>90%) atmosphere of 5% CO2/95% air.

Extracted molecule

total RNA

Extraction protocol

MT4 cells infected and uninfected were collected by centrifugation (225× g, 5 min, at 20 °C). Cells pellets were washed with PBS and cells were lysed with RNAzol reagent (Sigma-Aldrich). Virus-containing supernatants were filtered (0.45 μm pore size cellulose-acetate filter (VWR)), and stored at −80 °C. HIV-1 titer was measured by 10-fold serial infection of TZM-bl cells (NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH from Dr. John C. Kappes and Dr. Xiaoyun Wu) in triplicate, calculated by Reed-Muench method and expressed as 50% tissue culture infectious dose. Small RNA fraction was purified according to the RNAzol manufacturer’s protocol. The RNA concentration was determined on NanoDrop ONE (ThermoFisher Scientific) and the RNA sample quality control was performed on a 4200 TapeStation System
Briefly, only short fraction of RNA from MT4 cells infected by HIV-1 and MT4 cells not infected was used for the library preparation. The most critical step is the enzyme reaction catalyzed by ADP-ribosylcyclase (ADPRC, Sigma-Aldrich), which is an enzyme specific only for NAD-capped RNA but inactive on canonical RNA. Samples not treated by ADPRC were used as a negative control for non-specifically bound RNA. 100 μg of sRNA for each sample was incubated with 4-pentyn-1-ol (10%) and ADPRC (2.5 ug) in 50 mM Na-HEPES (pH 7.0) and 5 mM MgCl2 for 30 min at 37 °C. The reaction was stopped by phenol/ether extraction and RNA was ethanol precipitated. NAD-capped RNA was then biotinylated (biotin-PEG3-azide, 250 mM) via a copper-catalyzed azide-alkyne cycloaddition (CuAAC) in a freshly prepared mixture of CuSO4 (1 mM), THPTA (0.5 mM) and sodium ascorbate (2 mM) for 30 min at 25 °C, with shaking at 350 r.p.m. The biotinylated RNA was purified by phenol/ether extraction and ethanol precipitated. Mobicol Classic columns (MoBiTec, GmbH) were assembled and 50 μl of streptavidin Sepharose (GE Healthcare) was transferred to each column. After washing the beads by adding three times 200 μL of immobilization buffer (10 mM Na-HEPES, 1 M NaCl and 5 mM EDTA, pH 7.2) to each column and centrifuge at ≥16,100 g for 1 min at rt, the beads were blocked with acetylated BSA (100 μg/ml, Sigma-Aldrich) in 100 uL of immobilization buffer for 20 min at 20 °C, with shaking at 1,000 r.p.m. After three more washes, the RNA was immobilized on the beads for 1 h at 20 °C, with shaking at 1,000 r.p.m. The beads were washed five times with 200 μL of streptavidin wash buffer (50 mM Tris-HCl and 8 M urea, pH 7.4), then equilibrated by washing three times with 200 μL of 1x standard ligation buffer (50 mM Tris-HCl, 10 mM MgCl2, pH 7.4), blocked with acetylated BSA, and washed three more times with 1x standard ligation buffer as described previously. 30 μL of ligation mixture containing adenylated RNA 3′adaptor (5 μM, rApp-CNNNNNNAGATCGGAAGAGCACACGTCTG-(C3)), 1x standard ligation buffer, DMSO (15%, Sigma-Aldrich), acetylated BSA (1.5 μg), 2-mercaptoethanol (50 mM, Sigma-Aldrich), T4 RNA ligase (15 U, Thermo Fisher Scientific), and T4 RNA ligase 2, truncated K227Q(300 U, New England BioLabs) was added to the beads and the mixture was incubate at 4 °C overnight (≥16 h). The biotinylated RNA was rebound by adding 7.5 μL 5 M NaCl and incubated for 1 hour at 20 °C, with shaking at 1,000 r.p.m. After washing the beads five times with the streptavidin wash buffer, they were equilibrated by washing three times with 1× first-strand buffer (50 mM Tris-HCl, 75 mM KCl and 5 mM MgCl2, pH 8.3), blocked with acetylated BSA, and washed another three times with 1× first-strand buffer. The beads were covered with 30 μL of reverse transcription mixture containing dNTPs (0.5 mM each,company), acetylated BSA (1,5 μg), DTT (5 mM), 1x first strand buffer, reverse primer (5 uM, CAGACGTGTGCTCTTCCGAT), and Superscript III reverse transcriptase (300 U) and incubated for 1 hour at 37 °C. The rebinding procedure was repeated and samples were washed five times with streptavidin wash buffer and three times with 1x ExoI buffer (Thermo Scientific). The beads were blocked with acetylated BSA in ExoI buffer and again washed three times with 1x ExoI buffer. The free primers were digested by adding 30 μL of 1x ExoI buffer and 30 U of ExoI (Thermo Scientific) and the mixture was incubated for 30 min at 37 °C. The beads were washed five times with streptavidin wash buffer and three times with immobilization buffer. The RNA was digested by adding 100 μl of 0.15 M NaOH solution and incubating for 25 min at 55 °C. The columns were centrifuged and washed with 100 ul of H2O. The flow-through was ethanol precipitated and the cDNA pellet was dissolved in 19 μl of Terminal deoxynucleotidyl transferase (TdT) tailing mixture containing 1x TdT buffer (Thermo Scientific) and CTP (1.25 mM). After adding 20 U of TdT, the mixture was incubated in thermocycler for 30 min at 37 °C and after the enzyme was thermally denatured by heating to 70 °C for 10 min. Then, the second adaptor was ligated on the cDNA by adding 60 μl of reaction mixture containing 1x standard ligation buffer, cDNA anchor (5 μM each strand, sense: p-CAGATCGGAAGAGCGTCGTGT-(C3), antisense: ACACGACGCTCTTCCGATCTGGG), ATP (10 μM), and T4 DNA ligase (120 Weiss U, Thermo Scientific) and incubating for 16 h at 4 °C.PCR amplification was performed with barcoded PCR primers (Table) in 25 cycles inTaq DNA Pol reaction buffer 1 × (Thermo Scientific), with 1 μM of each barcoded primer, 0.2 mM dNTPs (each) and 2.5 U of DreamTaq DNA Polymerase (Thermo Scientific) in 50 μL of total reaction mixture. Initial denaturation was performed at 95 °C for 3 min, following by annealing for 30 s at 68 °C, elongation for 30 s at 72 °C and denaturation for 30 s at 95 °C. Final extension was performed at 72 °C for 5 min. PCR reaction mixture was loaded on 2.5% agarose gel (140 V for 2 h). Fractions between 100–400 nt were cut and DNA was extracted from the gel by Monarch DNA Gel extraction Kit (NEB). Multiplexed samples were submitted to the IMG Genomics and Bioinformatics facility for library synthesis using the NextSeq® 500/550 High Output Kit v2, 75 cycles (Illumina) and sequencing on a NextSeq 500/550, Illumina.
NADcapture shortRNA seq

Library strategy

OTHER

Library source

transcriptomic

Library selection

other

Instrument model

Illumina NextSeq 500

Description

MA4

Data processing

Library strategy: NAD captureSeq
Trimming: TrimGalore-v0.4.1
Mapping: Hisat2-v2.1.0
Read count quantification: Seqmonk-v.1.47.2
Genome_build: GRCh38
Supplementary_files_format_and_content: txt file containing raw read counts of short RNAs (miRNAs, miscRNAs, rRNAs, tRNAs, snRNAs, snoRNAs)

Submission date

Dec 15, 2021

Last update date

May 16, 2024

Contact name

Lenka Gahurova

E-mail(s)

lenka.veselovska@gmail.com

Organization name

University of South Bohemia

Department

Department of molecular biology and genetics