![](/coreweb/template1/pix/main_left_bg.gif) |
![](/coreweb/template1/pix/pixel.gif) |
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Jan 14, 2022 |
Title |
ht_Sham_rep08_batchB |
Sample type |
SRA |
|
|
Source name |
Hypothalamus
|
Organism |
Rattus norvegicus |
Characteristics |
tissue: Hypothalamus group: Sham strain: Wistar rat batch: B
|
Extracted molecule |
total RNA |
Extraction protocol |
Using a microscope with an attached freezing plate, hypothalami were removed from the brains and frozen on dry ice in Eppendorf tubes immediately. Tissue was homogenized using QIAGEN Tissue Lyser II (85300; QIAGEN) and further purified using Proteinase K (PK) Solution (MC5005; Promega). Prior to extraction, RNA integrity and concentration were tested using NanoDrop™ 2000c spectrophotometer (Thermo Fisher Scientific). In the following step, mRNA was extracted using Promega’s “Maxwell SimplyRNA Tissue Kit” (AS1340). RNA quality was checked using a 2100 Bioanalyzer with the RNA 6000 Nano kit (Agilent Technologies). The RIN for all samples was >7.2. DNA libraries suitable for sequencing were prepared from 100 ng of total RNA with oligo-dT capture beads for poly-A-mRNA enrichment using the TruSeq Stranded mRNA Library Preparation Kit (Illumina) according to manufacturer’s instructions. After 15 cycles of PCR amplification, the size distribution of the barcoded DNA libraries was estimated ~285/335 bp (batch A/batch B) by electrophoresis on Agilent DNA 1000 Bioanalyzer microfluidic chips.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina NextSeq 500 |
|
|
Data processing |
Base calling with Illumina NextSeq RTA v2.4.11 FASTQ conversion with bcl2fastq v2.20.0.422 FASTQ quality and adapter trimming using Cutadapt (Martin, 2011) version 1.16/2.1/2.5 (cutadapt parameters: --nextseq-trim=20 -m 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC) Alignment of trimmed reads to rat genome using STAR (Dobin et al., 2013) v2.7.2b with default parameters based on RefSeq annotation version 106 for GCF_000001895.5/Rnor_6.0 Calculation of read counts on exon level summarized for each gene (RefSeq annotation version 106 for GCF_000001895.5/Rnor_6.0) using featureCounts v1.6.4 from the Subread package (Liao et al., 2014). Multi-mapping and multi-overlapping reads were counted strand-specific and reversely stranded with a fractional count for each alignment and overlapping feature (command line parameters: -s 2 -t exon -M -O --fraction). Genome_build: GCF_000001895.5/Rnor_6.0 (primary assembly and mitochondrion) Supplementary_files_format_and_content: Character (TAB) separated value file containing mRNA abundance measurements
|
|
|
Submission date |
Dec 05, 2021 |
Last update date |
Jan 14, 2022 |
Contact name |
Tom Gräfenhan |
E-mail(s) |
ht-seq.sysmed@uni-wuerzburg.de
|
Phone |
+49 - 931 - 31 - 80814
|
Organization name |
University of Wuerzburg
|
Department |
Core Unit SysMed
|
Lab |
Raum D15.02.045
|
Street address |
Josef-Schneider-Str. 2, Bau D15
|
City |
Würzburg |
ZIP/Postal code |
97080 |
Country |
Germany |
|
|
Platform ID |
GPL20084 |
Series (1) |
GSE190218 |
Roux-en-Y gastric bypass and caloric restriction but not gut hormone-based treatments profoundly impact the hypothalamic transcriptome in obese rats |
|
Relations |
BioSample |
SAMN23668717 |
SRA |
SRX13321554 |
Supplementary data files not provided |
SRA Run Selector![Help](/coreweb/images/long_help4.gif) |
Raw data are available in SRA |
Processed data are available on Series record |
|
|
|
|
![](/coreweb/template1/pix/main_right_bg.gif) |