|
| Status |
Public on Feb 24, 2022 |
| Title |
HCT116_oligo_library_input_rep1 |
| Sample type |
SRA |
| |
|
| Source name |
oligo library (in human STARR-seq vector)
|
| Organism |
synthetic construct |
| Characteristics |
cell line: n/a
sample type: PCR amplified Plasmid library
|
| Growth protocol |
Human colon cancer cell line HCT116 was grown in DMEM (Gibco; 52100-047) supplemented with 10% heat inactivated FBS (Sigma; F7524) and 1% L-Glutamine (Sigma; G7513) at 37ºC. Cells were passaged every 2-3 days.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
6h after electroporation, total RNA was extracted using the RNeasy Maxi kit (Qiagen; cat. no. 75162), followed by polyA+ RNA isolation using Invitrogen Dynabeads Oligo(dT)25 (scaling up the manufacturer's protocol accordingly; cat. no. 61005) and DNase treatment with Ambion Turbo DNase (cat. no. AM2239) at a concentration of at most 200 ng/ul for 45 minutes (min) at 37C. The reactions were then subjected to cleanup with Beckman-Coulter AMPure XP beads (Product No: A63881), at a ratio of 1:1.8. STARR-seq transcripts were specifically reverse transcribed using a gene specific primer (CTCATCAATGTATCTTATCATGTCT), followed by RNaseA digest. After second strand synthesis (primer: GTCGTGAGGCACTGGGCA*G) we introduced a 10 bp unique molecular identifier (UMI) at the 3'end of the STARR-seq transcript (primer: CAAGCAGAAGACGGCATACGAGATNNNNNNNNNNGTGACTGGAGTTCAGACGTGT*G), followed by a PCR step across the spliced intron junction of the mature STARR-seq transcript (primers: TCGTGAGGCACTGGGCAG*G*T*G*T*C and CAAGCAGAAGACGGCATACG*A). Samples were amplified for Illumina sequencing with an Illumina i5 adapter and a custom i7 index primer (CAAGCAGAAGACGGCATACGAGA*T). All PCR steps were performed using the KAPA HiFi HotStart ReadyMix (Roche; Material Number 7958927001) and cleaned up with Beckman-Coulter AMPure XP beads (Product No: A63881) at an appropriate ratio. See Neumayr et al., Curr. Protoc. Mol. Biol. 2019 for more details.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
NextSeq 550 |
| |
|
| Data processing |
Library strategy: STARR-seq
Oligo library UMI-STARR-seq RNA and DNA input reads (150 bp) were mapped to a reference containing 249 bp long sequences containing both wildtype and mutated fragments from the Drosophila library using Bowtie v.1.2.2. We demultiplexed reads by the i5 and i7 indexes and subsequently by the oligo identity, since this library contained oligos from other experiments. Mapping reads with the correct length, strand and with no mismatches (to identify all sequence variants) were kept. Both DNA and RNA reads were collapsed by UMI (10 bp, allowing one mismatch; UMI sequences are in the sequencing read name) to ensure the counting of unique reporter transcripts.
We excluded oligos with less than 10 reads in any of the input replicates and added one read pseudocount to oligos with zero RNA counts. The enhancer activity of each oligo in each screen was calculated as the log2 fold-change over input, using both replicates, using DESeq2. We used the counts of wildtype negative regions in each library as scaling factors between samples. This normalization only changes the position of the zero and consequently does not affect the calculation of log2 fold-changes or the p-values for the statistical tests used.
Genome_build: hg19 (custom oligo library)
Supplementary_files_format_and_content: Table of all 22,900 human enhancer sequences and their motif-mutant sequences included in the oligo library, with genomic coordinates, oligo sequence, experiment, mutated motif, read counts for each screen and final enhancer activity (log2).
|
| |
|
| Submission date |
Sep 10, 2021 |
| Last update date |
Feb 24, 2022 |
| Contact name |
Bernardo P de Almeida |
| E-mail(s) |
bernardo.almeida@imp.ac.at
|
| Organization name |
Research Institute of Molecular Pathology (IMP)
|
| Lab |
Stark Lab
|
| Street address |
Campus-Vienna-Biocenter 1
|
| City |
Wien |
| ZIP/Postal code |
1030 |
| Country |
Austria |
| |
|
| Platform ID |
GPL27609 |
| Series (2) |
| GSE183938 |
DeepSTARR predicts enhancer activity from DNA sequence and enables the de novo design of synthetic enhancers [Human oligo UMI-STARR-seq] |
| GSE183939 |
DeepSTARR predicts enhancer activity from DNA sequence and enables the de novo design of synthetic enhancers |
|
| Relations |
| BioSample |
SAMN21390302 |
| SRA |
SRX12136178 |
