|
| Status |
Public on Apr 19, 2022 |
| Title |
E4_MII_Cnot6l_Het_smart_rep1 |
| Sample type |
SRA |
| |
|
| Source name |
Oocyte
|
| Organism |
Mus musculus |
| Characteristics |
genotype: Cnot6l Het
developmental stage: MII oocyte
molecule: polyA RNA
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Oocytes were collected from 4-5 weeks old Cnot6l-/- and Cnot6l+/- female mice. The MI oocytes and MII oocytes were similarly collected as described above. Due the limited number of Cnot6l+/- mice, we used C57BL/6 mice as control for Ribo-seq of FGOs, also as control for mRNA-seq of FGOs. Due to data quality, we used MI oocytes Ribo-seq rep12 as control.
The RNA-seq libraries were generated using the Smart-seq2 protocol as described previously
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 1500 |
| |
|
| Data processing |
Ribo-lite reads were trimmed with cutadapt v1.14 with parameters: cutadapt --trim-n -a GATCGGAAGAGCACACGTCTG -a AGAGCACACGTCTG <input.file> | cutadapt -u 3 -a A{100} --no-indels -e 0.16666666666666666 - | cutadapt -O 8 --match-read-wildcards -g GTTCAGAGTTCTACAGTCCGACGATCSSS -m 18 - -o <output.file> , and the trimmed reads were sequentially mapped to mouse/human rRNAs sequences (mm9/hg19) using Bowtie2 v2.2.2 with parameters --seedlen=23. Those aligned to rRNA were discarded, and the rest reads were mapped to transcriptome of mm9/hg19 using STAR v2.5.3a with parameters --outFilterMismatchNmax 2 --outFilterMultimapNmax 20 --outFilterMatchNmin 16 --alignEndsType EndToEnd. The gene expression level was then calculated by Cufflinks v2.2.1 based on the annotation of CDS region。
All mRNA-seq data were trimmed by Trim Galore v0.4.2 then mapped to transcriptome of mm9/hg19 by STAR v2.5.3a with parameters --outFilterMultimapNmax 20 --outSAMstrandField intronMotif. The gene expression level was calculated by Cufflinks v2.2.1.
Genome_build: mm9
|
| |
|
| Submission date |
Jan 29, 2021 |
| Last update date |
Apr 19, 2022 |
| Contact name |
Zhuqing Xiong |
| E-mail(s) |
lexizqxiong@gmail.com
|
| Organization name |
School of Life Science, Tsinghua Univers
|
| Street address |
Haidian District
|
| City |
Beijing |
| State/province |
FOREIGN |
| ZIP/Postal code |
100084 |
| Country |
China |
| |
|
| Platform ID |
GPL18480 |
| Series (1) |
| GSE165782 |
Ultrasensitive Ribo-seq reveals translational landscapes during mammalian oocyte-to-embryo transition and pre-implantation development |
|
| Relations |
| BioSample |
SAMN17678837 |
| SRA |
SRX9975681 |
