|
| Status |
Public on Sep 16, 2021 |
| Title |
DEEP_br1_myc |
| Sample type |
SRA |
| |
|
| Source name |
Skeletal muscle
|
| Organism |
Mus musculus |
| Characteristics |
strain: C57BL/6
cell type: Freshly isoalted muscle stem cell
age: post natal day 38
genotype: Pax7Cas9
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Genomic DNA was extracted by QuickExtract (Epicentre) solution.
Genomic DNAs from AAV9-sgRNA infected satellite cells were amplified using Q5 High-Fidelity 2× Master Mix (NEB). PCR products were purified through QIAQuick PCR purification kit (Qiagen) and subjected to library preparation using NEBNext® Ultra™ II DNA Library Preparation Kit (NEB).
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 1500 |
| |
|
| Description |
Myc_deep seq_rep1
|
| Data processing |
Library strategy: Deep-seq
Illumina Casava1.8 software used for basecalling.
Sequenced reads were trimmed for adaptor sequence using trimmomatic v0.36 with parameter SLIDINGWINDOW:4:15 MINLEN:50, and reads without primer(Fwd:5'-AGTTAAGACGACTCTCACGG-3' and Rev:AGGCCTCATTCACTTTGCTC) are removed,then mapped to mm9 and conduct editting pattern using CRISPResso2 with parameter -w 20 --max_paired_end_reads_overlap 150 --amplicon_min_alignment_score 40 --min_identity_score 40
Genome_build: mm9
Supplementary_files_format_and_content: folder(with all CRISPResso2 output files inside)
|
| |
|
| Submission date |
Sep 13, 2020 |
| Last update date |
Sep 16, 2021 |
| Contact name |
Yingzhe Ding |
| E-mail(s) |
1155068845@link.cuhk.edu.hk
|
| Organization name |
The Chinese University of Hong Kong
|
| Department |
Chemical Pathology
|
| Street address |
Rm503,Li Ka Shing Medical Science Build.,Prince of Wales Hosp.,30-32 Ngan SHing St.
|
| City |
Hong Kong |
| State/province |
Shatin NT. |
| ZIP/Postal code |
999077 |
| Country |
Hong Kong |
| |
|
| Platform ID |
GPL18480 |
| Series (2) |
| GSE134529 |
CRISPR/Cas9/AAV9-sgRNA Mediated In Vivo Genome Editing Reveals the Indispensability of Myc During Muscle Stem Cells Activation by Remodeling the 3D Chromatin |
| GSE157871 |
CRISPR/Cas9/AAV9-sgRNA Mediated In Vivo Genome Editing Reveals the Indispensability of Myc During Muscle Stem Cells Activation by Remodeling the 3D Chromatin [DEEP-seq(MyoD&Myc&Bcl6&Pknox2)] |
|
| Relations |
| BioSample |
SAMN16121597 |
| SRA |
SRX9112765 |
