NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM4694821 Query DataSets for GSM4694821
Status Public on Apr 22, 2021
Title CSR-1_degron_control_RNAi_ego-1_rep2_sRNA-seq
Sample type SRA
 
Source name nematodes
Organism Caenorhabditis elegans
Characteristics genotype: ieSi64 [gld-1p::TIR1::mRuby::gld-1 3'UTR + Cbr-unc-119(+)] II; csr-1(gc029[degron::mCherry::3xflag::ha::csr-1])
tissue: whole worm
developmental stage: Late L4 larval stage
treatment: ego-1 RNAi from L1 to 38 h, 0.5 % Ethanol (Auxin control) 38 h to 44 h
Treatment protocol Auxin treatment were performed by placing worms on plates containing 500 µM Auxin dissolved in Ethanol (at a final concentration of 0.5% ) from L1 to 38 H, worms were then transferred to NGM plates for CSR-1 expression recovery for 5 or 10 h for "CSR-1 expression recovery experiment". For experiment "CSR-1 degron and ego-1 RNAi experiment", synchronised worms were grown on NGM plates containing IPTG and seeded with bacteria either containing control RNAi vector or ego-1 RNAi clone from Ahringer library from L1 to 38 h, at 38 hours worms were transfered to plates containing either 500 µM Auxin or only 0.5 % Ethanol (control) and were grown for further 6 hours to deplete CSR-1. For "P-granule RNAi experiment", N2 worms were grown on IPTG NGM plates seeded with bacteria either expressing control RNAi vector or pDU49vector containing quadruple RNAi for glh-1, glh-4, pgl-1 and pgl-3 for two generations at 25 °C.
Growth protocol Strains were maintained at 20°C, using standard methods (Brenner, 1974) with the exception for "P-grnaule RNAi experimet"which was performed at 25 °C.
Extracted molecule total RNA
Extraction protocol Synchronous populations of worms were grown at 20°C on NGM plates seeded with OP50 E. coli concentrated food or otherwise described in treatment protocol , at a density of maximum 40,000 animals per 15 cm Petri dish. Worms were carefully monitored using a stereomicroscope and sorted using COPAS bio sorter at 44 h to enrich for late L4 stage larval population. Sorted worms were frozen in dry ice with Trizol reagent (Ambion). After five repetitions of freeze and thaw in dry ice, total RNA was isolated according to the Trizol Reagent protocol. Agilent 2200 TapeStation System was used to evaluate the RIN indexes of all the RNA preps, and only samples with RIN > 8 was used for downstream applications. 6 µg of total RNAs with RIN > 8 was size selected from 15% UREA PAGE gel and used to generate small RNA libraries.
The library preparation was performed as essentially described by Jayaprakash et al., 2011, except that a 5’ polyphosphatase (Lucigen RP8092H) treatment was performed to be able to clone tri-phosphate small RNAs, and that the PAGE gel extraction after each ligation was substitute with purification by 1.8 volumes of Agencourt RNAClean XP Beads (Beckman Coulter, NC0068576) and 3 volumes of isopropanol. The multiplexed amplified libraries were further purified using PippinPrep DNA size selection with 3% gel cassettes and the following parameters for the selection: BP start (115) and the BP end (165). The purified libraries were quantified using Qubit Fluorometer High Sensitivity dsDNA assay kit (ThermoFisher, Q32851) and sequenced either on NextSeq-500 Illumina platform using the NextSeq 500/550 High Output v2 kit 75 cycles (FC-404-2005).
 
Library strategy ncRNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina NextSeq 500
 
Description CSR-1 degron and ego-1 RNAi experiment
Data processing The 3' adaptor (TGGAATTCTCGGGTGCCAAGG) was trimmed from the raw reads using cutadapt (version 1.18)
The trimmed reads were sorted by sequence using fastq-sort (from fastq-tools version 0.8) with option -s and deduplicated using a custom haskell program, keeping the highest quality among duplicates, at any given position
The 5' and 3' 4 nt UMIs were removed from the deduplicated reads using cutadapt (version 1.18) with options -u 4 and -u -4
After removing UMIs, the reads from 18 to 24 nt were selected using bioawk version 20110810 (git commit fd40150b7c557da45e781a999d372abbc634cc21)
The size-selected reads were mapped on the C. elegans genome (WBcel235) using bowtie2 (version 2.3.4.3) with options -L 6 -i S,1,0.8 -N 0
The reads that failed to map were inspected using grep -E -B 1 -A 2 "^G[ACGTN]{20,25}T+$" to detect possible reads starting with G with 20 to 25 nt followed by a poly-U tail that might have prevented the mapping, and this tail was removed from such reads using a custom haskell program before re-mapping them.
Mapped and remapped reads were used to estimate the abundance of small RNAs derived from structural RNAs using featureCounts (version 1.6.3) with options -O -s 1 --fracOverlap 1 and annotations corresponding to tRNA, snRNA, snoRNA, rRNA or RNA (as annotated in the iGenome distribution of WBcel235 obtained at ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Caenorhabditis_elegans/Ensembl/WBcel235/Caenorhabditis_elegans_Ensembl_WBcel235.tar.gz)
The abundance of non-structural RNAs was estimated by subtracting the above counts from the number of mapped and remapped reads.
Initially mapped reads were classified using a custom python program according to their length, composition and on the annotations on which they mapped. Reads that didn't match miRNA and piRNA annotations were considered as potential endo-siRNAs.
The potential endo-siRNAs of size 21 to 23 nt that started with G were classified as “si_22G” if they mapped antisense to annotation belonging to the following categories: DNA transposons, RNA transposons, satellites, simple repeats (as annotated in http://hgdownload.cse.ucsc.edu/goldenPath/ce11/database/rmsk.txt.gz) or pseudogene or protein-coding genes (as annotated in the iGenome distribution of WBcel235 obtained at ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Caenorhabditis_elegans/Ensembl/WBcel235/Caenorhabditis_elegans_Ensembl_WBcel235.tar.gz)
The “si_22G” reads were re-mapped on the C. elegans genome (WBcel235) using bowtie2 (version 2.3.4.3) with options -L 6 -i S,1,0.8 -N 0
The resulting alignment was used to generate the normalized bigwig file using millions of non-structural RNAs as normalizer. This was done with a custom bash script using bedtools (version 2.27.1), bedops (version 2.4.35) and bedGraphToBigWig (version 4)
Genome_build: C. elegans ce11 (WBcel235)
Supplementary_files_format_and_content: bigwig files allowing to display the normalized abundance of “si_22G” RNAs along the genome
 
Submission date Jul 24, 2020
Last update date Apr 22, 2021
Contact name Germano Cecere
E-mail(s) germano.cecere@pasteur.fr
Phone 0033140613225
Organization name Institut Pasteur
Department Development and stem cell biology
Lab Mechanisms of Epigenetic Inheritance
Street address Institut Pasteur, 28 Rue Du Docteur Roux, Batiment Monod, 4eme Etage
City Paris
ZIP/Postal code 75724
Country France
 
Platform ID GPL19757
Series (2)
GSE155076 Translation and codon usage regulate Argonaute slicer activity to trigger germline small RNA biogenesis [ncRNA-seq]
GSE155077 Translation and codon usage regulate Argonaute slicer activity to trigger germline small RNA biogenesis
Relations
BioSample SAMN15639498
SRA SRX8819475

Supplementary file Size Download File type/resource
GSM4694821_CSR-1_degron_control_RNAi_ego-1_rep2_sRNA-seq_si_22GRNA_by_non_structural.bw 8.8 Mb (ftp)(http) BW
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap