 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 22, 2021 |
| Title |
FLAG_CSR-1_WT_lateL4_IP_rep1_sRNA-seq |
| Sample type |
SRA |
| |
|
| Source name |
nematodes
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
genotype: csr-1(gc017[csr-1::3xFLAG::1HA])
tissue: whole worm
developmental stage: Late L4 larval stage
treatment: none
antibody: FLAG
|
| Growth protocol |
Strains were maintained at 20°C, using standard methods (Brenner, 1974).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Synchronous populations of worms were grown at 20°C on NGM plates seeded with OP50 E. coli concentrated food at a density of maximum 40,000 animals per 15 cm Petri dish. Worms were carefully monitored using a stereomicroscope and sorted using COPAS bio sorter at 44 h to enrich for late L4 stage larval population. Harvested worms were suspended in the IP buffer (50 mM Tris, 500 mM NaCl, 5mM MgCl2 10 % glycerol, 1% NP40, protease inhibitor cocktails (Thermo Scientific, 1860932), 40U/mL RNase inhibitor) followed by 30 strokes using a metal dounce on ice. Crude protein extracts were centrifuged at 18,000 rpm at 4°C for 10 minutes. Protein concentration was quantified by the Bradford assay, and 500 µg of protein extract was incubated with 15 μl of packed Anti-FLAG M2 Magnetic Agarose Beads (Sigma M8823) for 2 hour at 4°C. After four washes with IP buffer, the beads were resuspended in 750 µL of TRIzol LS reagent (Ambion) to extract the immunoprecipitated RNAs. 750 µL of TRIzol LS reagent (Ambion) was also added to 10% of protein extract before the immunoprecipitation (Input). RNA extracted from IPs and Inputs were size selected from 15% UREA PAGE gel.
The library preparation was performed as essentially described by Jayaprakash et al., 2011, except that a 5’ polyphosphatase (lucigen RP8092H) treatment was performed to be able to clone tri-phosphate small RNAs, and that the PAGE gel extraction after each ligation was substitute with purification by 1.8 volumes of Agencourt RNAClean XP Beads (Beckman Coulter, NC0068576) and 3 volumes of isopropanol. The multiplexed amplified libraries were further purified using PippinPrep DNA size selection with 3% gel cassettes and the following parameters for the selection: BP start (115) and the BP end (165). The purified libraries were quantified using Qubit Fluorometer High Sensitivity dsDNA assay kit (ThermoFisher, Q32851) and sequenced either on NextSeq-500 Illumina platform using the NextSeq 500/550 High Output v2 kit 75 cycles (FC-404-2005).
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
FLAG CSR-1 WT IP or FLAG CSR-1 catalytic mutant IP experiment
|
| Data processing |
The 3' adaptor (TGGAATTCTCGGGTGCCAAGG) was trimmed from the raw reads using cutadapt (version 1.18)
The trimmed reads were sorted by sequence using fastq-sort (from fastq-tools version 0.8) with option -s and deduplicated using a custom haskell program, keeping the highest quality among duplicates, at any given position
The 5' and 3' 4 nt UMIs were removed from the deduplicated reads using cutadapt (version 1.18) with options -u 4 and -u -4
After removing UMIs, the reads from 18 to 24 nt were selected using bioawk version 20110810 (git commit fd40150b7c557da45e781a999d372abbc634cc21)
The size-selected reads were mapped on the C. elegans genome (WBcel235) using bowtie2 (version 2.3.4.3) with options -L 6 -i S,1,0.8 -N 0
The reads that failed to map were inspected using grep -E -B 1 -A 2 "^G[ACGTN]{20,25}T+$" to detect possible reads starting with G with 20 to 25 nt followed by a poly-U tail that might have prevented the mapping, and this tail was removed from such reads using a custom haskell program before re-mapping them.
Mapped and remapped reads were used to estimate the abundance of small RNAs derived from structural RNAs using featureCounts (version 1.6.3) with options -O -s 1 --fracOverlap 1 and annotations corresponding to tRNA, snRNA, snoRNA, rRNA or RNA (as annotated in the iGenome distribution of WBcel235 obtained at ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Caenorhabditis_elegans/Ensembl/WBcel235/Caenorhabditis_elegans_Ensembl_WBcel235.tar.gz)
The abundance of non-structural RNAs was estimated by subtracting the above counts from the number of mapped and remapped reads.
Initially mapped reads were classified using a custom python program according to their length, composition and on the annotations on which they mapped. Reads that didn't match miRNA and piRNA annotations were considered as potential endo-siRNAs.
The potential endo-siRNAs of size 21 to 23 nt that started with G were classified as “si_22G” if they mapped antisense to annotation belonging to the following categories: DNA transposons, RNA transposons, satellites, simple repeats (as annotated in http://hgdownload.cse.ucsc.edu/goldenPath/ce11/database/rmsk.txt.gz) or pseudogene or protein-coding genes (as annotated in the iGenome distribution of WBcel235 obtained at ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Caenorhabditis_elegans/Ensembl/WBcel235/Caenorhabditis_elegans_Ensembl_WBcel235.tar.gz)
The “si_22G” reads were re-mapped on the C. elegans genome (WBcel235) using bowtie2 (version 2.3.4.3) with options -L 6 -i S,1,0.8 -N 0
The resulting alignment was used to generate the normalized bigwig file using millions of non-structural RNAs as normalizer. This was done with a custom bash script using bedtools (version 2.27.1), bedops (version 2.4.35) and bedGraphToBigWig (version 4)
Genome_build: C. elegans ce11 (WBcel235)
Supplementary_files_format_and_content: bigwig files allowing to display the normalized abundance of “si_22G” RNAs along the genome
|
| |
|
| Submission date |
Jul 24, 2020 |
| Last update date |
Apr 22, 2021 |
| Contact name |
Germano Cecere |
| E-mail(s) |
germano.cecere@pasteur.fr
|
| Phone |
0033140613225
|
| Organization name |
Institut Pasteur
|
| Department |
Development and stem cell biology
|
| Lab |
Mechanisms of Epigenetic Inheritance
|
| Street address |
Institut Pasteur, 28 Rue Du Docteur Roux, Batiment Monod, 4eme Etage
|
| City |
Paris |
| ZIP/Postal code |
75724 |
| Country |
France |
| |
|
| Platform ID |
GPL19757 |
| Series (2) |
| GSE155075 |
Translation and codon usage regulate Argonaute slicer activity to trigger germline small RNA biogenesis [RIP-Seq] |
| GSE155077 |
Translation and codon usage regulate Argonaute slicer activity to trigger germline small RNA biogenesis |
|
| Relations |
| BioSample |
SAMN15639486 |
| SRA |
SRX8819444 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4694790_FLAG_CSR-1_WT_lateL4_IP_rep1_sRNA-seq_si_22GRNA_by_non_structural.bw |
6.1 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
