 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 22, 2021 |
| Title |
N2_2_WTcsr-1_lateL4_rep2_Ribo-seq |
| Sample type |
SRA |
| |
|
| Source name |
nematodes
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
genotype: N2
tissue: whole worm
developmental stage: Late L4 larval stage
treatment: none
|
| Growth protocol |
Strains were maintained at 20°C, using standard methods (Brenner, 1974). Bristol N2 was the wild-type strain used.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Synchronous populations of worms were grown at 20°C on NGM plates seeded with OP50 E. coli concentrated food or otherwise described in treatment protocol , at a density of maximum 40,000 animals per 15 cm Petri dish. Worms were carefully monitored using a stereomicroscope and sorted using COPAS bio sorter at 44 h to enrich for late L4 stage larval population. Sorted worms were lysed by freeze crushing in polysome buffer (140 mM KCl, 5 mM MgCl2, 20 mM Tris HCl pH 8, 1% Triton X-100, Halt protease inhibitor cocktail (Thermo Scientific, 1860932), RiboLock RNase Inhibitor (Thermo Scientific, EO0381), 0.1 mg/mL cycloheximide) in liquid nitrogen and the lysate was then treated with RNase I at 100 U/mg of lysate for 5 minutes at 37 °C. Lysates were then franctionated on a 10-50 % sucrose gradient by ultracentrifugation at 39000 rpm in a SW41-Ti rotor from Beckmann Coulter. RNA from monosome fraction was resolved on a on a TBE-Urea gel 15% and fragments of 28-30 nucleotides were size.
3’ phosphate and 5’-OH of 28-30 Ribosome protected fragments were repaired using Polynucleotide kinase (New England biolabs, M0201S). RNA was ligated to 3’end adapter using T4 RNA ligase 2 Truncated KQ and to 5’ adapter using T4 RNA ligase 1 (New England biolabs, M0204S). cDNA was PCR amplified with specific primers using Q5 High-Fidelity 2X Master Mix (New England biolabs, M0492S). The purified libraries were quantified using Qubit Fluorometer High Sensitivity dsDNA assay kit (ThermoFisher, Q32851) and sequenced either on NextSeq-500 Illumina platform using the NextSeq 500/550 High Output v2 kit 75 cycles (FC-404-2005).
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
Ribo-seq experiment comparing WT and csr-1knockout
|
| Data processing |
Library strategy: Ribo-seq
The 3' adaptor (TGGAATTCTCGGGTGCCAAGG) was trimmed from the raw reads using cutadapt (version 1.18)
The trimmed reads were sorted by sequence using fastq-sort (from fastq-tools version 0.8) with option -s and deduplicated using a custom haskell program, keeping the highest quality among duplicates, at any given position
The 5' and 3' 4 nt UMIs were removed from the deduplicated reads using cutadapt (version 1.18) with options -u 4 and -u -4
After removing UMIs, the reads from 28 to 30 nt were selected using bioawk version 20110810 (git commit fd40150b7c557da45e781a999d372abbc634cc21)
The size-selected reads were mapped on the C. elegans genome (WBcel235) using bowtie2 (version 2.3.4.3) with options -L 6 -i S,1,0.8 -N 0
The reads that failed to map were inspected using grep -E -B 1 -A 2 "^G[ACGTN]{20,25}T+$" to detect possible reads starting with G with 20 to 25 nt followed by a poly-U tail that might have prevented the mapping, and this tail was removed from such reads using a custom haskell program before re-mapping them.
Mapped and remapped reads were used to estimate the abundance of small RNAs derived from structural RNAs using featureCounts (version 1.6.3) with options -O -s 1 --fracOverlap 1 and annotations corresponding to tRNA, snRNA, snoRNA, rRNA or RNA (as annotated in the iGenome distribution of WBcel235 obtained at ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Caenorhabditis_elegans/Ensembl/WBcel235/Caenorhabditis_elegans_Ensembl_WBcel235.tar.gz)
The abundance of non-structural RNAs was estimated by subtracting the above counts from the number of mapped and remapped reads.
Initially mapped reads were classified using a custom python program according to their length, composition and on the annotations on which they mapped. Reads that didn't match miRNA and piRNA annotations were considered as potential endo-siRNAs.
The potential endo-siRNAs of size 21 to 23 nt that started with G were classified as “si_22G” if they mapped antisense to annotation belonging to the following categories: DNA transposons, RNA transposons, satellites, simple repeats (as annotated in http://hgdownload.cse.ucsc.edu/goldenPath/ce11/database/rmsk.txt.gz) or pseudogene or protein-coding genes (as annotated in the iGenome distribution of WBcel235 obtained at ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Caenorhabditis_elegans/Ensembl/WBcel235/Caenorhabditis_elegans_Ensembl_WBcel235.tar.gz)
The “si_22G” reads were re-mapped on the C. elegans genome (WBcel235) using bowtie2 (version 2.3.4.3) with options -L 6 -i S,1,0.8 -N 0
The resulting alignment was used to generate the normalized bigwig file using millions of non-structural RNAs as normalizer. This was done with a custom bash script using bedtools (version 2.27.1), bedops (version 2.4.35) and bedGraphToBigWig (version 4)
Genome_build: C. elegans ce11 (WBcel235)
Supplementary_files_format_and_content: bigwig files allowing to display the normalized abundance of “si_22G” RNAs along the genome
|
| |
|
| Submission date |
Jul 24, 2020 |
| Last update date |
Apr 22, 2021 |
| Contact name |
Germano Cecere |
| E-mail(s) |
germano.cecere@pasteur.fr
|
| Phone |
0033140613225
|
| Organization name |
Institut Pasteur
|
| Department |
Development and stem cell biology
|
| Lab |
Mechanisms of Epigenetic Inheritance
|
| Street address |
Institut Pasteur, 28 Rue Du Docteur Roux, Batiment Monod, 4eme Etage
|
| City |
Paris |
| ZIP/Postal code |
75724 |
| Country |
France |
| |
|
| Platform ID |
GPL19757 |
| Series (2) |
| GSE155073 |
Translation and codon usage regulate Argonaute slicer activity to trigger germline small RNA biogenesis [Ribo-Seq] |
| GSE155077 |
Translation and codon usage regulate Argonaute slicer activity to trigger germline small RNA biogenesis |
|
| Relations |
| BioSample |
SAMN15639434 |
| SRA |
SRX8819424 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4694770_N2_2_WTcsr-1_lateL4_rep2_Ribo-seq_RPF_by_RPF.bw |
13.5 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
