|
| Status |
Public on Jun 29, 2020 |
| Title |
sample.19_GFPnegEpCAMpos |
| Sample type |
SRA |
| |
|
| Source name |
GFP- EpCAM+ tumor derived cells (from 4T1-GFP tumors)
|
| Organism |
Mus musculus |
| Characteristics |
strain: BALB/c
Sex: female
tissue: Breast tumor
cell type: Non-immune cells derived from primary tumor
selection marker: Ter119- CD45- GFP- EpCAM+
treatment: Orthotopic breast injection of 4T1-GFP cells
time point: four weeks after injection
mouse age: 12 weeks
|
| Treatment protocol |
8 weeks old BALB/c females were injected under anaesthesia with 100,000 4T1-luc or 4T1-GFP cells suspended in PBS, directly into the lower left mammary fat pad. To obtain CAFs from primary tumors, mice were sacrificed and tumors were immediately excised post mortem.
|
| Growth protocol |
8 to 13 weeks-old mice housed at the Weizmann Institute animal facility under specific pathogen-free conditions.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Primary tumor was minced using scissors and treated with enzymatic digestion solution containing 3 mg ml-1 collagenase A and 70 unit ml-1 DNase in RPMI 1640 for 20 min at 37oC, with pipetting every 3 min. Lung metastases: Metastases bearing lungs were harvested and placed in gentleMACS C tubes with an enzymatic digestion solution containing collagenase A 1.5 mg ml-1, dispase II 2.5 unit ml-1 and DNase I 70 unit ml-1 in RPMI 1640. The tissue was disrupted for 30 min at 37oC using gentleMACS dissociator. Following dissociation, all tissues were washed, filtered through a 70 μm cell strainer and pelleted by centrifugation at 350 g, 5min, 4°C.
3' end mRNA libraries were prepared for sequencing using a method developed at Dr. Ido Amit's lab, Weizmann Institute of Science
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
Single end protocol R2 used for 8N UMI
|
| Data processing |
Illumina bcl2fastq software used for basecalling.
Reads were trimmed using cutadapt (DOI: 10.14806/ej.17.1.200) (parameters: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -a “A{10}” –times 2 -u 3 -u -3 -q 20 -m 25).
Reads were mapped to genome/shareDB/iGenomes/Mus_musculus/UCSC/mm10/Sequence/STAR_index/ using STAR (DOI: 10.1093/bioinformatics/bts635) v2.4.2a (parameters: –alignEndsType EndToEnd, –outFilterMismatchNoverLmax 0.05, –twopassMode Basic, –alignSoftClipAtReferenceEnds No).
Read count was performed with HTSeq-count (DOI: 10.1093/bioinformatics/btu638) in union mode.
Further analysis is done for genes having minimum 5 read in at least one sample.
Normalization of the counts and differential expression analysis was performed using DESeq2 (DOI: 10.1186/s13059-014-0550-8) with the parameters: betaPrior=True, cooksCutoff=FALSE, independentFiltering=FALSE. Raw P values were adjusted for multiple testing using the procedure of Benjamini and Hochberg.
Genome_build: mm10
Supplementary_files_format_and_content: tab-delimited text files include mRNA molecule count values for each Sample
|
| |
|
| Submission date |
Apr 30, 2020 |
| Last update date |
Jun 29, 2020 |
| Contact name |
Ido Amit |
| E-mail(s) |
ido.amit@weizmann.ac.il
|
| Phone |
972-8-9343338
|
| Organization name |
Weizmann Institute of Science
|
| Department |
Immunology
|
| Street address |
234 Herzl st.
|
| City |
Rehovot |
| ZIP/Postal code |
760001 |
| Country |
Israel |
| |
|
| Platform ID |
GPL19057 |
| Series (2) |
| GSE149634 |
Single cell mapping of breast tumor stroma reveals dynamically evolving compositions of cancer-associated fibroblasts along tumor progression (bulk RNA-seq dataset) |
| GSE149636 |
Single cell mapping of breast tumor stroma reveals dynamically evolving compositions of cancer-associated fibroblasts along tumor progression |
|
| Relations |
| BioSample |
SAMN14777162 |
| SRA |
SRX8213500 |
