 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Feb 03, 2020 |
| Title |
Riboseq.lizard.testis.wt.adult.rep1 |
| Sample type |
SRA |
| |
|
| Source name |
testis
|
| Organism |
Anolis carolinensis |
| Characteristics |
tissue: whole testis
genotype/variation: wt
age: adult
|
| Treatment protocol |
The mice were anesthetized with Ketamine/Xylazine mixture (Ketamine 100 mg/kg; Xylazine 25 mg/kg) via intraperitoneal injection. After complete anesthesia, testes were exteriorized with a longitudinal incision around 1 cm at the center of abdomen. The tunica albuginea was penetrated using a sharp 26 G needle (BD, Franklin Lakes, NJ, USA, 30511) 1 mm from the vascular pedicle, and the needle was withdrawn to generate path for introducing a blunt end Hamilton needle (Hamilton, Reno, NV, USA, 7786-02). PBS containing 0.02% Fast Green FCF (Thermo Fisher Scientific, Waltham, MA, USA) with harringtonine (LKT labs, 0.5 μg/μl in a total volume of 10 μl) or puromycin dihydrochloride (Invitrogen, 2.5 μg/μl in a total volume of 10 μl) was slowly injected using a Hamilton microsyringe (1705RN) into one testis, and vehicle control without drug was injected into the other testis. The needle was held in place for 30 seconds before removal to prevent back flow of the solution. Successful completion of injection was indicated by testis filled with green solution. The testes were returned to the abdominal cavity after injection. The incisions were sutured. At the end point, the mice were euthanized by cervical dislocation, and the testes were collected.
|
| Growth protocol |
Animals mice were maintained and used according to guidelines for animal care of the NIH and the University Committee on Animal Resources at the University of Rochester. Lizards were used according to guidelines for animal care of the NIH and the University Committee on Animal Resources at the University of Rochester.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNAs were extracted using mirVana miRNA Isolation Kit (ThermoFisher, AM1560), and rRNAs were depleted from total RNAs with complementary DNA oligomers (IDT) and RNaseH (Invitrogen, Waltham, MA, USA).
Ribo-seq: Testes samples were lysed, RNase T1 & A treated and loaded on sucrose gradients, and 80S monosomes were recovered for library construction. The 3'-adapter is TGGAATTCTCGGGTGCCAAGG and has been trimmed in the raw data.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
Ribosome footprints
|
| Data processing |
Library strategy: Ribo-seq
Analyses were performed using piPipes v1.4. All data from the small RNA sequencing, ribosome profiling (Ribo-seq), RNA sequencing, and degradome sequencing were analyzed using the latest mouse genome release mm10 (GCA_000001635.7), and green lizard genome release anoCar2 (GCA_000090745.1). Generally, one mismatch is allowed for genome mapping.
For small RNA sequencing, libraries were normalized to the sum of total miRNA reads; spike-in RNA was used to normalize the libraries with and without RNase treatment. Uniquely mapping reads >23 nt were selected for further piRNA analysis. To ensure precision of the mapping, a piRNA is counted only when the 5´-end of the piRNA maps to the uORF or UDR of a transcript.
For RNA-seq reads, the expression per transcript was normalized to the top quartile of expressed transcripts per library calculated by Cuffdiff, and the tpm (transcripts per million) value was quantified using the Salmon software.
For Ribo-seq analysis, uniquely mapping reads between 26 nt and 32 nt were selected for further analysis. Libraries from harringtonine treatment were further normalized to the sum of reads mapping to mitochondrial coding sequences. Libraries from puromycin treatment were further normalized to the sum of reads mapping to the 5´-UTR of mRNAs.
For Degradome data, reads were aligned to the genome using TopHat 2.0.12. Reads were mapped uniquely using the ‘-g 1’ flag. Uniquely mapping reads were selected for further analysis. Libraries were normalized to the sum of reads mapping to mRNA protein-coding regions, assuming that mRNA cleavage was largely unchanged during spermatogenesis.
Genome_build: Mouse: mm10 (GCA_000001635.7, GRCm38), Lizard: anoCar2 (GCA_000090745.1, AnoCar2.0).
Supplementary_files_format_and_content: For Small RNAseq, Ribo-seq and Degradome, processed data files are unique genome alignment results in BED2 format (https://github.com/bowhan/piPipes/wiki/smallRNA-seq). RNAseq quantification results are .sf files output by Salmon software.
|
| |
|
| Submission date |
Nov 14, 2019 |
| Last update date |
Feb 04, 2020 |
| Contact name |
Xin Li |
| E-mail(s) |
xin_li@urmc.rochester.edu
|
| Organization name |
University of Rochester Med Center
|
| Department |
Biochemistry and biophysics
|
| Lab |
Xin Li
|
| Street address |
601 Elmwood Ave.
|
| City |
Rochester |
| State/province |
NY |
| ZIP/Postal code |
14642 |
| Country |
USA |
| |
|
| Platform ID |
GPL15001 |
| Series (1) |
| GSE65786 |
Ribosomes guide pachytene piRNA formation on long intergenic piRNA precursors |
|
| Relations |
| BioSample |
SAMN13285522 |
| SRA |
SRX7141398 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4160724_Riboseq.lizard.testis.wt.adult.rep1.gz.x_rRNA.x_hairpin.anoCar2v1.unique.+jxn.bed13.txt.gz |
65.8 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
