|
| Status |
Public on Mar 11, 2020 |
| Title |
H4K16ac Heat shock rep1 |
| Sample type |
SRA |
| |
|
| Source name |
S2 cell line
|
| Organism |
Drosophila melanogaster |
| Characteristics |
heat shock: yes
recovery: no
antibody: H4K16ac
|
| Treatment protocol |
Control: Cells were incubated at 27˚C; Heat shock: Cells were incubated 1 h at 37˚C; 2h recovery: Cells were incubated 1 h at 37˚C. Then cold medium was added to decrease the temperature to 27˚C and cells were incubated for 2 h at 27˚C.
|
| Growth protocol |
S2 cells were grown in Schneider media supplemented with 1% penicillin/straptomycin and 10% heat-inactivated FBS at 27˚C until density of 4 million cells/ml.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Cells were washed with PBS and crosslinked with 1% formaldehyde for 5 min. Formaldehyde was quenched with glycine and incubated for 5 min. Cells were lysed and centrifuged to isolate nuclei. Nuclei were lysed and sheared with Covaris S220 to ~300 bp fragment sizes. SDS was quenched with Triton X-100 and extract was cleared by centrifugation. For IP, 2 µg of anti-H4K16ac Ab (Millipore, 07-329) was added per 1 ml of extract and incubated over night Complexes were captured on Protein G DynaBeads and washed with Low salt, High salt, LiCl and TE buffer. Complexes were eluted with proteinase K treatment followed by over night decrosslinking at 65˚C. DNA was isolated using PCR purification kit (Quiagen).
Libraries were constructed according to Bowman et al. (2012, BMC Genomics)
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Data processing |
Adaptor sequences were removed using Cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -m 3
Reads were aligned to reference genome using bowtie2
Aligned reads were filtered for MAPQ > 2 woth samtools
Sample enrichment over input was calcualted using MACS2
Enrichment bedgraph files were converted to bigWig format
Genome_build: dm6
Supplementary_files_format_and_content: bigWig files contain track of sample enrichemnt over input
|
| |
|
| Submission date |
Sep 13, 2019 |
| Last update date |
Mar 12, 2020 |
| Contact name |
Matthew D Simon |
| E-mail(s) |
matthew.simon@yale.edu
|
| Phone |
2037373274
|
| Organization name |
Yale University Chemical Biology Instiute
|
| Department |
Molecular Biophysics & Biochemistry
|
| Lab |
Simon Lab
|
| Street address |
600 West Campus Dr. MIC312
|
| City |
West Haven |
| State/province |
CT |
| ZIP/Postal code |
06516 |
| Country |
USA |
| |
|
| Platform ID |
GPL25244 |
| Series (2) |
| GSE120220 |
Harnessing enhanced nucleotide chemistry and toehold nanotechnology to reveal lncRNA spreading on chromatin |
| GSE137401 |
ChIP of H4K16ac |
|
| Relations |
| BioSample |
SAMN12742372 |
| SRA |
SRX6845079 |
