|
| Status |
Public on Nov 15, 2019 |
| Title |
Planktonic_total_RNA_Rep1 |
| Sample type |
SRA |
| |
|
| Source name |
hfq::3xFLAG_P
|
| Organism |
Pseudomonas aeruginosa |
| Characteristics |
strain: PAO1
genotype: hfq::3xFLAG
growth condition: Planktonic (LB, 37degreeC, 180 rpm, OD600 = 2.0)
protocol: UV light (254 nm, 800 mJ/cm2) irradiation
|
| Treatment protocol |
Biofilms from the same biological replicate were scraped with sterilized loop into 200 ml LB medium. Cultures which were irradiated with UV light (254 nm, 800 mJ/cm2) were used.
|
| Growth protocol |
For planktonic culture, overnight culture of P. aeruginosa PAO1 strain containing hfq::3xFLAG allele was diluted 1:100 into 200 ml fresh LB medium and maintained up to an OD600 of 2.0. For biofilm condition, 10 μl aliquot of 1:100 diluted overnight culture was seeded on a cellulose membrane placed on the LB agar and incubated statically for 48 hours.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Bacteria were lysed and total RNA was purified with hot phenol extraction followed by chloroform extraction and ethanol precipitation.
cDNA preparation and high-throughput sequencing were performed at Vertis Biotechnologie AG, Freising, Germany.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
P_1
|
| Data processing |
Total RNA-seq reads in FASTQ format were quality and adapter-trimmed via Cutadapt (Martin, 2011) version 1.15 using a cut-off Phred score of 20 in NextSeq mode and reads without any remaining bases were discarded (command line parameters: --nextseq-trim=20 -m 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC)
Remaining reads longer than 11 nt were aligned to the P. aeruginosa reference genomes (NC_002516) using READemption version 0.4.5 (Förstner et al., 2014) and segemehl (Hoffmann et al., 2014) version 0.2.0 with accuracy cut-off of 95%
Each read with a minimum overlap of 1 nt was counted with a value based on the number of locations where the read was mapped using READemption (Förstner et al., 2014). If the read overlapped more than one annotation, the respective value was counted once for each overlapping region.
The resulting read counts were subjected to differential expression analysis of planktonic vs. biofilm samples via DESeq2 version 1.18.1 with parameter for fold-change shrinkage of “betaPrior=TRUE”.
Genome_build: P. aeruginosa genomes (NC_002516)
Supplementary_files_format_and_content: read counts were subjected to differential expression analysis of planktonic vs. biofilm samples via DESeq2 version
|
| |
|
| Submission date |
Aug 21, 2019 |
| Last update date |
Nov 15, 2019 |
| Contact name |
Kotaro Chihara |
| E-mail(s) |
kchihara@niid.go.jp
|
| Organization name |
National institute of infectious diseases
|
| Department |
Research Center for Drug and Vaccine Development
|
| Street address |
1-23-1 Toyama
|
| City |
Tokyo |
| ZIP/Postal code |
162-8640 |
| Country |
Japan |
| |
|
| Platform ID |
GPL21297 |
| Series (2) |
| GSE136111 |
Conditional Hfq association with small non-coding RNAs in Pseudomonas aeruginosa revealed through comparative UV crosslinking immunoprecipitation followed by high-throughput sequencing [RNA-Seq] |
| GSE136112 |
Conditional Hfq association with small non-coding RNAs in Pseudomonas aeruginosa revealed through comparative UV crosslinking immunoprecipitation followed by high-throughput sequencing |
|
| Relations |
| BioSample |
SAMN12614883 |
| SRA |
SRX6747953 |
