|
| Status |
Public on Jul 11, 2019 |
| Title |
HEK293T-HEKsite2-miniABEmax-rep3 |
| Sample type |
SRA |
| |
|
| Source name |
HEK293T
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HEK293T
treatment: miniABEmax-P2A-EGFP
guide rna: HEKsite2 guide:GAACACAAAGCATAGACTGC
gfp: All GFP
|
| Treatment protocol |
Transfections were performed using 50ug of transfection quality plasmid DNA (Qiagen Maxiprep) encoding desired ABEmax-P2A-EGFP or bpNLS-32AAlinker-nCas9-bpNLS-P2A-EGFP and gRNAs (nuclease-to-gRNA ratio 75:25%). 7x10E6 HEK293T were seeded into TC-treated 150mm plates 18-24h prior to transfection to yield ~60-80 % confluency on the day of transfection. Cells were transfected using 150uL TransIT-293 (HEK293T, Mirus) reagents per plate, according to the manufacturers’ protocols (mixing DNA and reagent in 5mL Optimem, 30min incubation). Cells were sorted 36-40h after transfection, for all GFP signal after doublet-exclusion and gating for the cell population on a BD FACSARIA II.
|
| Growth protocol |
HEK293T cells (CRL-3216, obtained from ATCC) were grown in culture using media consisting of DMEM (Gibco) supplemented with 10% FBS (Gibco) and 1% penicillin-streptomycin (Gibco). Cells were used for experiments until passage 20 and passaged at ~80% confluency every 2-4 days to maintain an actively growing population and avoid anoxic conditions. Cells were tested for mycoplasma bi-weekly.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA was extracted with Macherey-Nagel’s NucleoSpin RNA Plus kit.
Illumina TruSeq Stranded Total RNA Gold, IDT-ILM unique dual indices for barcoding.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Description |
246C
miniABEmax
processed data: ABE_SECURE_counts.tsv
|
| Data processing |
RNA sequencing data was aligned to the human reference genome (GRCh38/hg38) using STAR using a basic two-pass alignment strategy. Aligned reads were filtered for those reads that were uniquely mapping using the --outFilterMultimapNmax 1 flag.
Variants associated with BE treatment were called using the GATK best practices pipeline using GATK 3.8.1 and Picard 2.7.
No samples were excluded from bioinformatics analyses.
Genome_build: hg38 (GRCh38)
Supplementary_files_format_and_content: ABE_SECURE_counts.tsv: Raw gene expression counts per gene estimated by STAR.
|
| |
|
| Submission date |
Apr 16, 2019 |
| Last update date |
Jul 11, 2019 |
| Contact name |
Caleb Lareau |
| E-mail(s) |
lareauc@mskcc.org
|
| Organization name |
Memorial Sloan Kettering
|
| Street address |
417 E 68th St, Zuckerman - ZRC 1132
|
| City |
New York |
| State/province |
New York |
| ZIP/Postal code |
10065 |
| Country |
USA |
| |
|
| Platform ID |
GPL24676 |
| Series (2) |
| GSE129889 |
CRISPR adenine and cytosine base editors with reduced RNA off-target activities [ABE] |
| GSE129894 |
CRISPR adenine and cytosine base editors with reduced RNA off-target activities |
|
| Relations |
| BioSample |
SAMN11435875 |
| SRA |
SRX5694062 |
