 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jan 22, 2019 |
| Title |
NP_sel2R2 |
| Sample type |
SRA |
| |
|
| Source name |
whole bacterial cells
|
| Organism |
Vibrio cholerae C6706 |
| Characteristics |
strain: C6706
genotype: <delta>vchM <delta>rpoE + psRNA library (sel 2 R2)
induction: 1mM IPTG
treatment: 3.5% ethanol
molecule subtype: plasmid DNA
|
| Treatment protocol |
The cells were treated with 3.5% ethanol in exponential phase phase (OD600=0.2). After 6 hours of treatment, cells were plated on LB agar and grown overnight. At least 1 million clones were harvested by washing colonies off the plates with sterile PBS. Cell suspensions from one replicate were pooled and centrifuged. Cell pellets were stored at -20°C until further processing.
|
| Growth protocol |
Vibrio cholerae C6706 ΔrpoE strains carrying the respective sRNA library were grown to exponential phase (OD600=0.2) in 10ml LB media containing 20µg/ml chloramphenicol and 1mM IPTG. At this point 3.5% ethanol was added for 6 hours. Cells were plated on LB agar containing 20µg/ml chloramphenicol and grown overnight.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Plasmid DNA was isolated using the PureYield™ Plasmid Midiprep System (Promega) and digested with XbaI and XhoI. The sRNA fragments were isolated by agarose gel extraction and used as input for library generation.
Sequencing libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, #E7645) according to the manufacturers instructions. Quality of the prepared libraries was tested using a Bioanalyzer.
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
genomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina MiSeq |
| |
|
| Data processing |
Sequencing of the libraries was performed by the Genomics Service Unit (LMU, Andreas Brachmann).
Sequencing reads were imported into CLC Genomics Workbench v10.0 and analysed using mostly standard parameters.
Trimming of the 5' PL promoter sequence and the 3' RybB backbone sequence was performed using the trim reads command with the following settings: 1. PL promoter Sequence = GGATAACAAGATACTGAGCAC, Strand = Plus, Action = Remove adapter, Scores = Mismatch: 2, Gapcost: 3, Cutoff: 10, Cutoff at end: 4; 2. RybB backbone Sequence = CACAAAATGGGGACATCAAAGAAA, Strand = Minus, Action = Remove adapter, Scores = Mismatch: 2, Gapcost: 3, Cutoff: 10, Cutoff at end: 4; 3. Filter on length: Discard reads below 9 nt, Discard reads above 9 nt
Resulting sequence lists with all 9 nt variants were exported as tab delimited text.
Exported text files were used as input for the python script "Frequency Analyzer" to count the abundance of any of the 262.144 possible variants, generating file "sRNA_libraries_variant_counts". (Python script available on Github: https://github.com/Loxos/srna-tool-kit-python)
File "sRNA_libraries_variant_counts" was used as input for the python script "Result Filter" to filter for variants that were detected in sel 0, sel 3 R1 and sel 3 R2, generating file "sRNA_libraries_variant_counts_sel3". (Python script available on Github: https://github.com/Loxos/srna-tool-kit-python)
Supplementary_files_format_and_content: count table for all possible 262.144 sRNA variants, csv format
Supplementary_files_format_and_content: count table for all sRNA variants that were detected in sel 0, sel 3 R1 and sel 3 R2, csv format
|
| |
|
| Submission date |
Jan 16, 2019 |
| Last update date |
Jan 23, 2019 |
| Contact name |
Kathrin Fröhlich |
| E-mail(s) |
kathrin.froehlich@uni-jena.de
|
| Organization name |
Friedrich-Schiller-Universität Jena
|
| Department |
Fakultät für Biowissenschaften, Bacterial RNA Biology
|
| Lab |
AG Fröhlich
|
| Street address |
Winzerlaer Straße 2
|
| City |
Jena |
| State/province |
Thuringia |
| ZIP/Postal code |
07745 |
| Country |
Germany |
| |
|
| Platform ID |
GPL26051 |
| Series (2) |
| GSE125161 |
Identification of variant distribution in ethanol-selected sRNA libraries |
| GSE125224 |
A conserved seed-pairing domain affords small RNA-mediated stress resistance in enterobacteria |
|
| Relations |
| BioSample |
SAMN10755165 |
| SRA |
SRX5254546 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
