GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM3560215

Query DataSets for GSM3560215

Status

Public on Jul 05, 2019

Title

Root Ribo-seq sample 2

Sample type

SRA

Source name

4-day old roots

Organism

Solanum lycopersicum

Characteristics

organ: roots
cultivar: Heinz 1706-BG

Treatment protocol

Seedlings that germinated around the same time and of similar size were selected for the experiments. Root (2.5-3 cm from the tip) from ~180 plants were harvested at ZT 3 (3 hours after light on) in batches and immediately frozen in liquid nitrogen.

Growth protocol

For each replicate, ~300 tomato seeds (Heinz HG1706) were surface-sterilized by 70% ethanol 5 minutes followed by bleach solution (~2.4% NaHClO, 0.3% Tween20) for 30 minutes with shaking. The seeds were then washed with sterile water for 5 times. Next, the seeds were stratified on 1x MS media (4.3 g/L MS salt, 1% sucrose, 0.5 g/L MES, pH 5.7, 1% agar), kept at 22 °C in the dark for 3 days before grown under 16-hour light/8-hour dark at 22°C for 4 days.

Extracted molecule

total RNA

Extraction protocol

The frozen tissues were pulverized with liquid nitrogen using a pestle and a mortar. About 0.4 g tissue powder was resuspended in 1.2 ml lysis buffer described in Hsu et al. 2016 (100 mM Tris·HCl (pH 8), 40 mM KCl, 20 mM MgCl2, 2% (vol/vol) polyoxyethylene (10) tridecyl ether (Sigma P2393), 1% sodium deoxycholate (Sigma D6750), 1 mM DTT, 100 μg/mL cycloheximide, and 10 unit/mL DNase I (Epicenter D9905K)). After incubation on ice with gentle shaking for 10 minutes, the lysate was spun at 4°C at 20,000 g for 10 minutes. The supernatant was transferred to new tube, and 100 µL and 200 µL aliquots were created. The aliquoted lysates were flash frozen with liquid nitrogen and stored at -80°C until ready to be processed.
For RNA-seq samples, 10 µL 10% SDS was added to the above 100 µL lysate. RNA greater than 200 nt was extracted using Zymo RNA clean and concentrator kit (Zymo Research R1017). The obtained RNA was checked by a Bioanalyzer (Agilent) RNA pico chip to access the RNA integrity, and a RIN value ranging from 9.2 to 9.4 was obtained for each replicate. Ribosomal RNAs (rRNAs) were depleted using RiboZero Plant Leaf kit (Epicenter/illumina MRZPL1224). Next, 100 ng of the rRNA-depleted RNA was used as the starting materials and fragmented to ~200 nt size based on the RIN reported by Bioanalyer following the NEBNext Ultra Directional RNA Library Prep Kit (NEB E7420S) to create strand-specific libraries. The libraries were barcoded and enriched using 11 cycles of PCR amplification. Equal molarity of the libraries was pooled and sequenced using Hi-Seq 4000 PE-100. The Ribo-seq samples were prepared according to Hsu et al. 2016 with minor modifications. Briefly, the RNA concentration of each lysate was first determined by Qubit RNA HS assay using a 10-fold dilution. Next, the 200 µL lysate above was treated with 100 units of Nuclease (provided by the TruSeq Mammalian Ribo Profile Kit, illumina RPHMR12126) per 40 µg of RNA with gently shaking at room temperature for one hour. The nuclease reaction was stopped by immediately transferred to ice and adding 15 µL of SUPERase-IN (Invitrogen AM2696). The ribosomes were isolated using illustra MicroSpin S-400 HR Columns (GE Healthcare 27514001). The RNA greater than 17 nt was purified first, and then RNA smaller than 200 nt was enriched using the RNA Clean & Concentrator Kit (Zymo Research R1017). Next, the rRNAs were depleted using the RiboZero Plant Leaf kit (Epicenter/illumina MRZPL1224). The rRNA-depleted RNA was then separated by 15% (wt/vol) TBE-urea PAGE (Invitrogen EC68852BOX), and gel slices ranging from 28 to 30 nt were excised. Ribosome footprints were recovered from the excised gel slices following the overnight elution method and the sequencing libraries were constructed according to the TruSeq Mammalian Ribo Profile Kit manual. The final libraries were amplified by 9 cycles of PCR. Equal molarity of the libraries was pooled and sequenced using Hi-Seq 4000 SE-50.

Library strategy

OTHER

Library source

transcriptomic

Library selection

other

Instrument model

Illumina HiSeq 4000

Description

ribosome-protected mRNA fragment
P_sites_sort_count and translated_ORFs_filtered_sorted.bed

Data processing

RNA-seq: step A: remove contamination sequences with bowtie2 v2.3.4. with the following steps: 1. remove contamination sequences. Used bowtie2 -L 20 -p 24 parameters. Contamination sequences are from SL3.0 repeat aggressive sequences and SL2.5 snRNA, snoRNA, rRNA and tRNA sequences) 2. samtools v1.8: convert sam to bam with samtools view. 3. Extract unmapped reads: Used samtools view -b -f 12 -F 256 parameters. 4. Sort bam file by read names with samtools 5. Split paired-end reads into separated fastq files with bamToFastq. 6. gzip the fastq files.
Ribo-seq: step A: remove adapter and contamination sequences: remove adaptors with fastx_clipper (FASTX_Toolkit v0.0.14) with the following parameters -a AGATCGGAAGAGCACACGTCT -l 20 -c -n -v -Q33 2. remove contamination sequences with bowtie2 using the following parameters -L 20 -p 16
RNA-seq: step B: mapping of the RNA-seq reads: STAR v2.6.0c 1. Create STAR index for RNA-seq reads: STAR --runThreadN 24 --runMode genomeGenerate --genomeDir $newINDEX --genomeFastaFiles $FASTA --sjdbGTFfile $GTF --sjdbOverhang 99 (here the $newINDEX is the directory for the STAR index file, $GTF is the standard ITAG3.2 annotation, and $FASTA is the SL3.0 fasta). 2. mapping: STAR --runThreadN 24 --genomeDir $newINDEX --readFilesCommand zcat --readFilesIn R1_r1.fastq.gz R1_r2.fastq.gz --alignIntronMax 15000 --alignIntronMin 15 --outFilterMismatchNmax 2 --outFilterMultimapNmax 20 --outFilterType BySJout --alignSJoverhangMin 8 --alignSJDBoverhangMin 1 --outSAMtype BAM SortedByCoordinate --quantMode TranscriptomeSAM --outSAMmultNmax 1 --outMultimapperOrder Random --outFileNamePrefix "star_R1” 3. index the bam file: samtools index star_R1_Aligned.sortedByCoord.out.bam
RNA-seq: step C: de novo assembly with for each stringtie v1.3.5 and compare with ITAG3.2b with gffcompare v.o.10.1: 1. assemble for each replicate (here show R1 example): stringtie --rf -p 16 -G ITAG3.2.gtf -o R1.gtf -l star_R1_Aligned.sortedByCoord.out.bam 2. combine the 3 root gtfs: stringtie --merge -p 12 -T 0.05 -G ITAG3.2.gtf -o Tomato_Root_merged.gtf mergeList.txt (here mergeList.txt is a list of gtf file names in rows). 3. compare with ITAG3.2: gffcompare -V -r $GTF -o Tomato_Root_ITAG_vs_de_novo Tomato_Root_merged.gtf
RNA-seq and Ribo-seq: step D: The i, x, y, o, u, s classes of the novel transcripts from Tomato_Root_ITAG_vs_de_novo.annotated.gtf (in the gffcompare output folder) were extracted and combined with ITAG3.2 in R (v3.4.3) to generate Tomato_Root_ixyous+IATG3.2.gtf file. Both RNA-seq and Ribo-seq reads are mapped to the new gtf and SL3.0 genome assembly using STAR with the same parameter listed above. Next, resulting bam files for three RNA-seq and three Ribo-seq data were merged with samtools merge, sorted by genome coordinates with samtools sort and indexed with samtools index.
Preparing ribotaper annotation file: use the SL3.0 genome sequence fasta and Tomato_Root_ixyous+IATG3.2.gtf files to generate the annotation files for RiboTaper (v1.3.0). Load bedtools v2.17.0 and run create_annotations_files.bash Tomato_Root_ixyous+IATG3.2.gtf SL3.0.fa false false $path_to_OUTPUT $path_to_BEDTOOL $path_to_riboTaper_scripts/
Run riboTaper (v1.3.0) parameter: 24,25,26,27,28 8,9,10,11,12
Genome_build: ITAG3.2

Submission date

Jan 11, 2019

Last update date

Jul 05, 2019

Contact name

Polly Hsu

E-mail(s)

pollyhsu@msu.edu

Organization name

Michigan State University

Department

Biochemistry and Molecular Biology