 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 25, 2019 |
| Title |
GCM-treated_rat_microglia_DNaseI-seq_rep2 |
| Sample type |
SRA |
| |
|
| Source name |
GCM-treated_rat_microglia_DNaseI-seq
|
| Organism |
Rattus norvegicus |
| Characteristics |
strain: Wistar
age: neonate; 1-day-old
cell type: microglia
condition: cell culture
treatment: conditioned media from rat C6 glioma cultures (GCM
|
| Treatment protocol |
Microglia were stimulated with 100 ng/mL LPS from Salmonella enteritidis (Sigma-Aldrich, Saint Louis, MO, USA) or conditioned media from rat C6 glioma cultures (GCM). C6 glioma cells (ATTC) were grown in DMEM medium with 10% FBS (Gibco), and antibiotics (100 U/mL penicillin, and 0.1 mg/mL streptomycin). The medium was changed every 3-4 days. After seeding 1 x 10^6 C6 cells onto 100-mm dishes, standard culture media were exchanged for 8 ml of 10% FBS high-glucose DMEM with Glutamax and conditioned media were harvested after 24 h from 85-90% confluent cultures and centrifuged at 300 x g for 10 min to remove cell debris.
|
| Growth protocol |
Microglial cultures were prepared from 1-day-old Wistar rat pups as previously described (Aleksandra Ellert-Miklaszewska et al. 2013; A. Ellert-Miklaszewska et al. 2016). Cerebral cortices were dissociated mechanically and by trypsinisation, and cells were plated at a density of 3 x 10^5 cells/cm2 on poly-L-lysine-coated flasks in Dulbecco’s modified Eagle medium, DMEM (with Glutamax, 4.5 g/L glucose, 10% heat-inactivated fetal bovine serum (FBS), 100 U/mL penicillin, and 0.1 mg/mL streptomycin). Cells were maintained at 37ºC in a humidified atmosphere of 5% CO2/95% (Heraeus, Hanau, Germany). Culture medium was changed after 3 days and then twice a week. After 2 weeks, microglial cells were recovered from confluent cultures by mild shaking and centrifugation (300 x g for 5 min). Cell viability was determined by trypan blue exclusion. Cells were suspended in a culture medium and plated at a density of 2-3 x 10^5 cells/cm2 onto culture dishes for cells growing in suspension (Sarstaed) and incubated for 48 h prior to experiments.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Briefly, 10^6 – 5 x 10^6 microglial cells (the same number of cells for each condition) were stimulated for 6 h with 100 ng/ml LPS, GCM or left untreated. Then, cells were lysed, nuclei were collected and digested 10 min at room temperature with a series of DNaseI dilutions (0.2-3.2 U/reaction, Roche Diagnostics). Digested DNA was enclosed in low melting point (LMP) agarose blocks. DNAse-I activity at different concentrations was determined using pulsed field gel electrophoresis (PFGE) and the CHEF-DRII apparatus (Biorad), and DNAseI activity at three optimal concentrations was selected for further processing.
DNA fragment ends were repaired and a “linker 1” (HPLC-purified, annealed oligonucleotides: AGTTCCTTGGCACCCGAGAATTCCATCCGAC and GTCGGATGGAATTCTCGGGTGCCAAGG) using T4 DNA ligase (1 U/μL) and ligation buffer (10X) (Roche Diagnostics). DNA with a ligated “linker 1” was isolated from agarose blocks and digested with MmeI enzyme (2 U/μL; New England Biolabs). Fragments containing “linker1” were purified using streptavidin beads (Dynal M-280; Invitrogen). Subsequently, a “linker 2” (HPLC-purified, annealed oligonucleotides: GATCGTCGGACTGTAGAACTCTGAAC and GTTCAGAGTTCTACAGTCCGACGATCNN) was ligated to DNA on beads and the beads were treated with 0.15 M NaOH to denature DNA. The obtained DNA fragments attached to the streptavidin beads were used as a template for PCR reaction performed with primers containing the standard Ilumina library preparation sequences and indexes. PCR products were resolved in 3% agarose gels and purified from gel using DEAE-cellulose chromatography papers, and sequenced on Illumina Hi-seq 1500.
|
| |
|
| Library strategy |
DNase-Hypersensitivity |
| Library source |
genomic |
| Library selection |
DNAse |
| Instrument model |
Illumina HiSeq 1500 |
| |
|
| Description |
2GCM_All_Lanes_All_Samples
|
| Data processing |
for each sample, all component fastq files were merged into one fastq file. Example: cat EXP1/MG_2GCM_S5_L007_R1_001.fastq.gz,EXP1/MG_2GCM_S5_L008_R1_001.fastq.gz,EXP1/MG_2GCM_S5_L005_R1_001.fastq.gz,EXP1/MG_2GCM_S5_L004_R1_001.fastq.gz,EXP1/MG_2GCM_S5_L006_R1_001.fastq.gz,EXP1/MG_2GCM_S5_L001_R1_001.fastq.gz,EXP1/MG_2GCM_S5_L003_R1_001.fastq.gz,EXP1/MG_2GCM_S5_L002_R1_001.fastq.gz > 2GCM_All_Lanes_All_Samples.fastq (upon gzip decompression)
raw sequence reads of 26 bp length were filtered by minimum threshold quality 30 in minimum 90% of the bases with fastq_quality_filter from FASTX-Toolkit version 0.0.14. Configuration: `fastq_quality_filter -q 30 -p 90`
Adapter removal was done with cutadapt version 1.8.3
The reads were then trimmed to length 20 by fastx_trimmer. After preprocessing, any reads of length less than 20 were discarded. Configuration: `fastx_trimmer -l 20 -m 20`
reads were mapped to rat genome rn5 with bowtie version 1.1.2 with parameters: `-v 2 -m 1 --all --best --strata -S`
Genome_build: rn5
Converting sam files into bam files with `samtools view -b`. samtools version 1.1.2
Sorting bam files with `samtools sort`
indexing bam files with `samtools index`
reads were de-duplicated with Picard (Picard Tools version 1.95) using default settings. As a result of the modified sequencing protocol, the DNaseI cut site was placed at the 3' end of the read. Since most software works on 5' end, reads were reversed by swapping the 0 and 16 flags in .sam files. This action has changed the strandedness of the reads, but it's irrelevant as long as further analyses disregard the strandedness.
DNase-I hotspots identified with hotspot algorithm on each bam file (hotspot: https://github.com/rthurman/hotspot)
Supplementary_files_format_and_content: *.fdr0.01.hot.bed (FDR thresholded hotspots, bed files for all samples)
Defining open chromatin regions in rat microglia across treatment conditions: intersection of hotspots from both replicates of a condition were defined as condition-specific, reproducible regions. Overlapping condition-specific regions from two or more conditions were then merged (union). At this stage, total number of defined open chromatin regions is 129,499.
We calculated the number of cuts (5’ ends of reads) in each region (using countDNaseCuts.py, url link below). Second, raw counts were converted into Counts per Milion (CPM) per Base. Third, only regions with CPMs per base greater than 0.001 in at least two samples were used for further steps. Total number of regions after this step is 126,640. Fourth, differential analysis was performed with DiffBind and edgeR package. (pipeline: https://bitbucket.org/seventm/dnase)
Supplementary_files_format_and_content: 1. Tab-delimited text file with coordinates of all defined regions, and counts of raw DNase-I cuts in all replicates. 2. csv files containing quantitative and statistical details of differential analysis for GCMvsUntreated and LPSvsUntreated.
|
| |
|
| Submission date |
Dec 04, 2018 |
| Last update date |
Jul 25, 2019 |
| Contact name |
Michał Dąbrowski |
| E-mail(s) |
m.dabrowski@nencki.edu.pl
|
| Organization name |
Nencki Institute of Experimental Biology
|
| Lab |
Laboratory of Molecular Neurobiology
|
| Street address |
Pasteura 3
|
| City |
Warsaw |
| ZIP/Postal code |
02-093 |
| Country |
Poland |
| |
|
| Platform ID |
GPL18404 |
| Series (1) |
| GSE123328 |
Open chromatin landscape of rat microglia upon inflammatory or pro-invasive polarization |
|
| Relations |
| BioSample |
SAMN10519591 |
| SRA |
SRX5094898 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM3500809_2GCM_picard_mapped_sorted_reversed.fdr0.01.hot.bed.gz |
1.6 Mb |
(ftp)(http) |
BED |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
