 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 18, 2019 |
| Title |
gWT/gMUT library Rep3 RNA |
| Sample type |
SRA |
| |
|
| Source name |
RW.4 mESCs
|
| Organism |
Mus musculus |
| Characteristics |
strain background: 129X1/SvJ
cell line: RW.4
cell type: Embryonic stem cell
passage number: 3-4
|
| Treatment protocol |
Approximately 1 million RW.4 cells were seeded in 6-well plates and transfected with 3 ug of MPRA library plasmid (SYN or gWT/gMUT ) and 0.3 ug of CF128, a GFP control plasmid.
|
| Growth protocol |
RW4 mouse ESCs (ATCC SCRC-1018) were cultured on on 2% gelatin coated plates in standard media (DMEM, 10% fetal bovine serum, 10% newborn calf serum, nucleoside supplement, 1000 U/ml leukemia inhibitory factor (LIF), and 0.1 uM B-mercaptoethanol)
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was extracted from approximately 9 million cells using the PureLink RNA mini kit (Life Technologies) according to the manufactor's instructions, removing any residual DNA from the RNA pool using TURBO DNA-free kit (Life Technologies).
First strand cDNA was prepared from total RNA using SuperScript RT III (Life Technologies) with oligo dT primers. Target library reporter sequences were amplified from cDNA and DNA pools using primers CF150, 'TACACCGTGGTGGAGCAGTA', and CF151b, 'AGCGTACTCGAGTTGTTAACTTGTTTATTGCAGCTT', followed by digestion with XbaI and XhoI (NEB). Digested amplicons were then ligated to custom Illumina adapters,each including an in-line barcode sequence to identify each sample. Ligated products were then further amplified using primers CF52, 'AATGATACGGCGACCACCGAG', and CF53, 'CAAGCAGAAGACGGCATACGA'.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
Demultiplexing barcode sequence of 'TAGAGTA' upstream of restriction site sequence 'CTAGAC' and then a 9bp designed library
|
| Data processing |
All raw reads (SRA accession number SRR7515851) were process regardless of quality scores. Briefly, reads with the expected in-line multiplexing barcode sequence for each replicate followed by the restriction site used for library construction were identified. Demultiplexed reads were then used to determine the number of unique occurances of 9 bp sequences in the barcoded region of the reporter construct. Barcodes that exactly matched designed sequences were then written to file along with the barcode's raw read count, all other counts were discarded.
Supplementary_files_format_and_content: Processed count text files include read counts in first column, barcode sequence in second column, and the putative regulatory element/sequence identifier in the last column.
|
| |
|
| Submission date |
Sep 20, 2018 |
| Last update date |
Sep 20, 2019 |
| Contact name |
Dana M King |
| E-mail(s) |
d.king@wustl.edu
|
| Organization name |
Washington University
|
| Department |
Department of Genetics
|
| Lab |
Cohen
|
| Street address |
4523 CLAYTON AVE, CB 8510
|
| City |
St. Louis |
| State/province |
Missouri |
| ZIP/Postal code |
63110 |
| Country |
USA |
| |
|
| Platform ID |
GPL19057 |
| Series (1) |
| GSE120240 |
Massively Parallel Reporter Assay for pluripotency factors in mESCs |
|
| Relations |
| BioSample |
SAMN09643645 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM3396582_GEN_Rep3_mRNA.counts.txt.gz |
60.0 Kb |
(ftp)(http) |
TXT |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
