 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 26, 2018 |
| Title |
DNA-PKcs KD/KD -2 |
| Sample type |
SRA |
| |
|
| Source name |
B cells
|
| Organism |
Mus musculus |
| Characteristics |
cell type: anti-CD40 and Il4 activated B cells
genotype: DNA-Pkcs KD/KD
strain: 129
|
| Treatment protocol |
Cells were cultured for 4 days and analyzed via flow cytometry before DNA extraction.
|
| Growth protocol |
Purified splenic B (CD43-) cells from mice carrying preassembled IgH and IgK loci (129Sv background) were cultured in RPMI mediume with cytokines (anti-CD40 (1 ng/mL; BD Pharmingen) and IL-4 (20 ng/mL; R&D)). Due to low splenic B cell number, DNA-PKcs KD/KDTp53-/- splenic cells were used for stimulation without purification.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Genomic DNA was extracted from day 4 cultured B cells.
Libraries were prepared according to protocol in (Hu J, et al. Nat Protoc 11:853–871.(2016)) Linear amplifications were performed using Sμ-specific biotin primer 5′/5BiosG/CAGACCTGGGAATGTATGGT3′) and followed by nesting PCR with (5′CACACAAAGACTCTGGACCTC3′) AflII is used to remove germ-line sequence.
high-throughput genome translocation sequencing (HTGTS). Sequenced with MiSeq 500v
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Description |
DNA_PKcs_KD_KD_pool_results.xlsx
|
| Data processing |
Library strategy: HTGTS
Basecalls performed using Illumina RTA version 1.18.54
Miseq reads was first de-multiplexed by fastq-multx tool from ea-util, then adaptor sequence was further trimmed with SeqPrep utility.
Pre-processed reads were then mapped to customized mm9 genome (mm9sr) with IgH switch region (from JH4 to the last Cα exon, chr12 114, 494, 415–114, 666, 816) of the C57/BL6 replaced by the corresponding region of 129 strain in NCBI gene accession sequence AJ851868.3 using Bowtie2. The best-path searching algorithm (related to YAHA; ref. 50) was used to identify optimal sequence alignments from Bowtie2-reported top alignments (alignment score > 50).
The reads are then filtered to exclude mispriming events, germ-line (unmodified) sequence, sequential joints, and duplicated reads. A “duplicate read” is defined by bait and prey alignment coordinates within 2 nt of another read’s bait and prey alignments. To plot all of the S-region junctions, including those in the repeats but unequivocally mapped to an individual switch region, we combined the ones filtered by a mappability filter but unequivocally mapped to S regions with “good” reads passing both the mappability (both deduplicated) filters (please see ref. 28 for simulation and details on plotting). MHs are defined as regions of 100% homology between the bait and prey-break site. Insertions are defined as regions containing nucleotides that map to neither the bait and prey-break site. Blunt junctions are considered to have no MHs or insertions.
Mutation rate was calculated by custom Excel integrated VBA script. Mutations were determined by comparing the actual bait sequence of each IgH junction with the germ-line bait sequence based on the IgH sequence from 129/Sv strain (NCBI gene accession no. AJ851868.3). Only true mismatches (no insertion or deletion within 7 nt) were counted as a mutation.
Genome_build: mm9sr (to customized mm9 genome (mm9sr) with IgH switch region (from JH4 to the last Cα exon, chr12 114, 494, 415–114, 666, 816) of the C57/BL6 replaced by the corresponding region of 129 strain in NCBI gene accession sequence AJ851868.3)
Supplementary_files_format_and_content: .xlsx files generated from tab-delimited text files after analysis for reads distribution and mutation rates.
|
| |
|
| Submission date |
Jul 25, 2018 |
| Last update date |
Jul 26, 2018 |
| Contact name |
Zhengping Shao |
| E-mail(s) |
zs2275@cumc.columbia.edu
|
| Phone |
212-851-4785
|
| Organization name |
Columbia University Medical Center
|
| Department |
ICG
|
| Lab |
Shan Zha Lab
|
| Street address |
1130 St. Nicholas Ave
|
| City |
New Yprk |
| State/province |
New York |
| ZIP/Postal code |
10033 |
| Country |
USA |
| |
|
| Platform ID |
GPL16417 |
| Series (1) |
| GSE117628 |
Kinase-dependent structural role of DNA-PKcs during immunoglobulin class switch recombination |
|
| Relations |
| BioSample |
SAMN09711848 |
| SRA |
SRX4455232 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM3305310_DNA_PKcs_KD_KD_2_results.xlsx.gz |
449.1 Kb |
(ftp)(http) |
XLSX |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
